Incidental Mutation 'R1927:Enpp1'
ID 214960
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms PC-1, E-NPP1, Npps, Pca, Pdnp1, CD203c, twy, NPP1, 4833416E15Rik, Pca-1, Ly-41
MMRRC Submission 039945-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R1927 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 24513812-24588057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24530786 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 557 (D557N)
Ref Sequence ENSEMBL: ENSMUSP00000101159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105520
AA Change: D557N

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: D557N

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135846
AA Change: D557N

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: D557N

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,613,338 (GRCm39) S31P probably damaging Het
Abca12 G T 1: 71,283,999 (GRCm39) H2524Q probably damaging Het
Acsl5 T C 19: 55,266,586 (GRCm39) V135A probably benign Het
Actl11 T G 9: 107,806,736 (GRCm39) L353R possibly damaging Het
Adcy6 G T 15: 98,496,379 (GRCm39) probably null Het
B230104I21Rik A G 4: 154,425,694 (GRCm39) I697T probably damaging Het
BC061237 G A 14: 44,738,700 (GRCm39) R33K possibly damaging Het
Brf1 C A 12: 112,963,964 (GRCm39) V5F possibly damaging Het
Chmp2a C T 7: 12,767,863 (GRCm39) A21T possibly damaging Het
Cwh43 A G 5: 73,610,417 (GRCm39) N607S probably benign Het
Ddhd2 G A 8: 26,231,688 (GRCm39) L445F possibly damaging Het
Dicer1 C A 12: 104,669,143 (GRCm39) D1180Y possibly damaging Het
Dnaaf4 A T 9: 72,867,909 (GRCm39) I57L probably damaging Het
Dock5 A T 14: 68,083,511 (GRCm39) S133T possibly damaging Het
Efs A T 14: 55,154,620 (GRCm39) C540S possibly damaging Het
Ehd4 C T 2: 119,921,973 (GRCm39) G428S probably benign Het
Eml1 C T 12: 108,504,476 (GRCm39) R812* probably null Het
Fn3krp A G 11: 121,315,803 (GRCm39) T65A probably damaging Het
Galnt5 A G 2: 57,888,615 (GRCm39) R72G probably benign Het
Gfod1 C T 13: 43,354,336 (GRCm39) R213H possibly damaging Het
Gm10518 A G 1: 179,631,210 (GRCm39) probably benign Het
Gm5431 A G 11: 48,780,082 (GRCm39) F558S probably damaging Het
Got1 C T 19: 43,504,119 (GRCm39) probably null Het
Gucy2g C T 19: 55,226,191 (GRCm39) V242I probably benign Het
Hdgfl2 T A 17: 56,406,874 (GRCm39) V606E possibly damaging Het
Hoxa3 T C 6: 52,146,979 (GRCm39) probably benign Het
Iqub T A 6: 24,491,670 (GRCm39) I339L probably benign Het
Kdm4c C T 4: 74,263,720 (GRCm39) T668I probably benign Het
Klhl32 T C 4: 24,617,474 (GRCm39) I592V probably benign Het
Mfsd12 G T 10: 81,197,921 (GRCm39) M296I probably benign Het
Mfsd4b4 C T 10: 39,768,437 (GRCm39) A219T probably damaging Het
Mrpl52 T C 14: 54,664,414 (GRCm39) S9P possibly damaging Het
Nbr1 A G 11: 101,458,040 (GRCm39) Y273C possibly damaging Het
Ncf4 G T 15: 78,144,846 (GRCm39) G217V probably damaging Het
Neo1 T C 9: 58,897,668 (GRCm39) E96G probably benign Het
Nid2 T A 14: 19,818,344 (GRCm39) N279K probably damaging Het
Nr5a2 A G 1: 136,872,732 (GRCm39) Y56H probably damaging Het
Ntn4 C T 10: 93,543,215 (GRCm39) R314W probably damaging Het
Nynrin A G 14: 56,101,049 (GRCm39) T280A probably benign Het
Or1o2 A G 17: 37,542,434 (GRCm39) Y276H probably damaging Het
Or2b28 T A 13: 21,531,116 (GRCm39) I6N probably benign Het
Or2w2 A G 13: 21,758,426 (GRCm39) F67L probably benign Het
Or55b10 A G 7: 102,143,266 (GRCm39) S239P possibly damaging Het
Or5b109 T C 19: 13,212,393 (GRCm39) Y260H probably damaging Het
Otog G A 7: 45,895,707 (GRCm39) C107Y probably damaging Het
Ptprn A G 1: 75,230,766 (GRCm39) V565A probably benign Het
Rbm6 T G 9: 107,730,102 (GRCm39) D182A probably damaging Het
Rhbg A G 3: 88,151,859 (GRCm39) F400L probably benign Het
Rpl22l1 T A 3: 28,860,738 (GRCm39) N33K possibly damaging Het
Rtp1 T A 16: 23,249,959 (GRCm39) I108N probably damaging Het
Sema6b A T 17: 56,439,797 (GRCm39) F15I probably benign Het
Sirpa C T 2: 129,458,296 (GRCm39) T304I possibly damaging Het
Slc22a29 A G 19: 8,184,430 (GRCm39) I257T probably benign Het
Slc41a1 T C 1: 131,768,938 (GRCm39) I256T probably damaging Het
Smg6 A G 11: 75,033,674 (GRCm39) K1208R probably damaging Het
Sorcs1 G T 19: 50,210,633 (GRCm39) P744Q probably damaging Het
Sptbn5 T C 2: 119,900,943 (GRCm39) T213A probably benign Het
St18 A G 1: 6,872,936 (GRCm39) T224A probably benign Het
Stat3 T C 11: 100,785,655 (GRCm39) N465S probably damaging Het
Stmn2 T A 3: 8,610,636 (GRCm39) M40K probably benign Het
Tespa1 A G 10: 130,184,108 (GRCm39) D63G probably benign Het
Thrb T A 14: 18,008,674 (GRCm38) C133S probably damaging Het
Tmem25 C T 9: 44,707,780 (GRCm39) V172M possibly damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trhde T A 10: 114,636,754 (GRCm39) Y151F probably damaging Het
Trp53bp2 A G 1: 182,280,229 (GRCm39) T912A probably damaging Het
Unc79 C A 12: 103,135,951 (GRCm39) A2269E probably damaging Het
Zfp507 C T 7: 35,493,150 (GRCm39) R631Q probably damaging Het
Zfp758 T G 17: 22,594,823 (GRCm39) S436R probably damaging Het
Zfp791 G T 8: 85,837,312 (GRCm39) T184K probably benign Het
Znrf3 A G 11: 5,231,062 (GRCm39) V817A probably benign Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24,521,325 (GRCm39) missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24,529,929 (GRCm39) missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24,540,512 (GRCm39) missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24,531,754 (GRCm39) missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24,517,859 (GRCm39) missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24,555,083 (GRCm39) splice site probably benign
IGL02691:Enpp1 APN 10 24,587,790 (GRCm39) missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24,536,172 (GRCm39) missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24,531,779 (GRCm39) splice site probably benign
IGL03330:Enpp1 APN 10 24,540,804 (GRCm39) splice site probably benign
IGL03365:Enpp1 APN 10 24,544,923 (GRCm39) missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24,536,181 (GRCm39) critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24,529,848 (GRCm39) missense probably benign 0.16
R0011:Enpp1 UTSW 10 24,545,900 (GRCm39) nonsense probably null
R0201:Enpp1 UTSW 10 24,529,815 (GRCm39) missense probably benign 0.00
R0496:Enpp1 UTSW 10 24,547,950 (GRCm39) missense probably benign 0.18
R1228:Enpp1 UTSW 10 24,521,310 (GRCm39) missense probably benign 0.30
R1536:Enpp1 UTSW 10 24,517,732 (GRCm39) missense probably benign 0.27
R2051:Enpp1 UTSW 10 24,587,702 (GRCm39) critical splice donor site probably null
R2057:Enpp1 UTSW 10 24,536,090 (GRCm39) missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24,527,239 (GRCm39) missense probably benign 0.24
R4077:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4079:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4739:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4740:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4761:Enpp1 UTSW 10 24,517,849 (GRCm39) missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24,537,833 (GRCm39) missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24,523,983 (GRCm39) missense probably benign 0.01
R5140:Enpp1 UTSW 10 24,528,750 (GRCm39) missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24,527,288 (GRCm39) missense probably benign
R5421:Enpp1 UTSW 10 24,545,655 (GRCm39) missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24,530,806 (GRCm39) missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24,530,817 (GRCm39) missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24,523,137 (GRCm39) missense probably benign
R5942:Enpp1 UTSW 10 24,551,966 (GRCm39) nonsense probably null
R6048:Enpp1 UTSW 10 24,536,152 (GRCm39) missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24,533,024 (GRCm39) missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24,517,780 (GRCm39) missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24,523,929 (GRCm39) missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24,545,653 (GRCm39) nonsense probably null
R6793:Enpp1 UTSW 10 24,531,723 (GRCm39) missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24,527,237 (GRCm39) missense probably benign 0.30
R7255:Enpp1 UTSW 10 24,521,213 (GRCm39) missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24,536,059 (GRCm39) missense probably benign 0.01
R7401:Enpp1 UTSW 10 24,521,180 (GRCm39) missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7430:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7526:Enpp1 UTSW 10 24,550,308 (GRCm39) splice site probably null
R7532:Enpp1 UTSW 10 24,551,885 (GRCm39) missense probably benign 0.29
R7789:Enpp1 UTSW 10 24,529,981 (GRCm39) splice site probably null
R8073:Enpp1 UTSW 10 24,555,142 (GRCm39) missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24,550,554 (GRCm39) missense probably benign 0.25
R8955:Enpp1 UTSW 10 24,544,926 (GRCm39) missense probably benign 0.01
R9494:Enpp1 UTSW 10 24,527,234 (GRCm39) missense probably benign
Z1177:Enpp1 UTSW 10 24,537,840 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AATCATATGTATGTGTGGGTCTACG -3'
(R):5'- CACTATACATAGGTGTGCATGTGTAC -3'

Sequencing Primer
(F):5'- AAGTCACCTAACATGGGG -3'
(R):5'- TGTACATATGTGTGCAATGCAG -3'
Posted On 2014-07-14