Incidental Mutation 'R1927:Znrf3'
ID214965
Institutional Source Beutler Lab
Gene Symbol Znrf3
Ensembl Gene ENSMUSG00000041961
Gene Namezinc and ring finger 3
SynonymsLOC382477
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location5276324-5444847 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5281062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 817 (V817A)
Ref Sequence ENSEMBL: ENSMUSP00000105493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109867] [ENSMUST00000172492]
PDB Structure
mouse ZNRF3 ectodomain crystal form I [X-RAY DIFFRACTION]
mouse ZNRF3 ectodomain crystal form II [X-RAY DIFFRACTION]
mouse ZNRF3 ectodomain crystal form III [X-RAY DIFFRACTION]
mouse ZNRF3 ectodomain crystal form IV [X-RAY DIFFRACTION]
mouse ZNRF3 ectodomain crystal form V, disulfide-bridged S90C variant [X-RAY DIFFRACTION]
Mouse ZNRF3 ectodomain in complex with mouse RSPO2 Fu1-Fu2 crystal form I [X-RAY DIFFRACTION]
Mouse ZNRF3 ectodomain in complex with Xenopus RSPO2 Fu1-Fu2 (Seleno Met) crystal form I [X-RAY DIFFRACTION]
Mouse ZNRF3 ectodomain in complex with Xenopus RSPO2 Fu1-Fu2 (Seleno Met) crystal form II [X-RAY DIFFRACTION]
Structure of ZNRF3 ectodomain [X-RAY DIFFRACTION]
Structure of ZNRF3-RSPO1 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000109867
AA Change: V817A

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105493
Gene: ENSMUSG00000041961
AA Change: V817A

DomainStartEndE-ValueType
signal peptide 1 52 N/A INTRINSIC
PDB:4CDK|D 53 205 1e-103 PDB
transmembrane domain 218 235 N/A INTRINSIC
RING 290 330 1.56e-6 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172492
AA Change: V721A

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134698
Gene: ENSMUSG00000041961
AA Change: V721A

DomainStartEndE-ValueType
PDB:4CDK|D 2 109 5e-70 PDB
transmembrane domain 122 139 N/A INTRINSIC
RING 194 234 1.56e-6 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 449 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit complete lethality around birth, aphakia, abnormal lens development and defective enural tube closure in some mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Other mutations in Znrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Znrf3 APN 11 5289039 missense probably damaging 1.00
IGL01387:Znrf3 APN 11 5338656 nonsense probably null
IGL02895:Znrf3 APN 11 5289085 missense probably damaging 0.97
R0788:Znrf3 UTSW 11 5281320 missense probably benign 0.04
R1383:Znrf3 UTSW 11 5281994 missense probably damaging 0.96
R1544:Znrf3 UTSW 11 5289066 missense probably damaging 1.00
R1556:Znrf3 UTSW 11 5281347 missense probably benign 0.01
R1586:Znrf3 UTSW 11 5281477 missense probably damaging 1.00
R1852:Znrf3 UTSW 11 5287455 missense possibly damaging 0.94
R1864:Znrf3 UTSW 11 5283373 missense possibly damaging 0.95
R2353:Znrf3 UTSW 11 5281170 missense probably damaging 1.00
R2884:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R2885:Znrf3 UTSW 11 5289693 missense probably damaging 1.00
R4021:Znrf3 UTSW 11 5281278 missense possibly damaging 0.68
R4811:Znrf3 UTSW 11 5287420 missense probably benign 0.07
R4935:Znrf3 UTSW 11 5283422 missense probably damaging 1.00
R5218:Znrf3 UTSW 11 5281519 missense possibly damaging 0.95
R5584:Znrf3 UTSW 11 5286218 missense probably damaging 1.00
R5698:Znrf3 UTSW 11 5289006 intron probably benign
R5715:Znrf3 UTSW 11 5286239 missense possibly damaging 0.91
R5900:Znrf3 UTSW 11 5282110 missense probably damaging 0.98
R5988:Znrf3 UTSW 11 5281776 missense probably damaging 1.00
R6253:Znrf3 UTSW 11 5280865 missense probably benign 0.14
R7057:Znrf3 UTSW 11 5282442 missense probably benign 0.00
R7062:Znrf3 UTSW 11 5281550 missense probably damaging 1.00
R7410:Znrf3 UTSW 11 5288955 missense unknown
R7881:Znrf3 UTSW 11 5444533 missense unknown
Z1177:Znrf3 UTSW 11 5286168 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTCATCTGTTCTCACCTGAAGC -3'
(R):5'- TTGCCCTGCTGCTTCTATGAAG -3'

Sequencing Primer
(F):5'- AGACTCCTGAGTGTCCTGG -3'
(R):5'- CTTCTATGAAGAGAAGCAGGTGGC -3'
Posted On2014-07-14