Incidental Mutation 'R1927:Stat3'
ID214970
Institutional Source Beutler Lab
Gene Symbol Stat3
Ensembl Gene ENSMUSG00000004040
Gene Namesignal transducer and activator of transcription 3
Synonyms1110034C02Rik, Aprf
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100885098-100939540 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100894829 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 465 (N465S)
Ref Sequence ENSEMBL: ENSMUSP00000121677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092671] [ENSMUST00000103114] [ENSMUST00000127638] [ENSMUST00000138438]
Predicted Effect probably damaging
Transcript: ENSMUST00000092671
AA Change: N491S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000090342
Gene: ENSMUSG00000004040
AA Change: N491S

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 2.2e-62 PFAM
Pfam:STAT_bind 321 574 1.8e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103114
AA Change: N491S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040
AA Change: N491S

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 7.2e-62 PFAM
Pfam:STAT_bind 321 574 5.7e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127638
AA Change: N491S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120152
Gene: ENSMUSG00000004040
AA Change: N491S

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 141 319 6.8e-59 PFAM
Pfam:STAT_bind 321 573 2.5e-80 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137367
Predicted Effect probably damaging
Transcript: ENSMUST00000138438
AA Change: N465S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121677
Gene: ENSMUSG00000004040
AA Change: N465S

DomainStartEndE-ValueType
STAT_int 2 123 5.47e-35 SMART
coiled coil region 171 195 N/A INTRINSIC
coiled coil region 243 265 N/A INTRINSIC
Pfam:STAT_bind 295 548 9.2e-131 PFAM
SH2 556 637 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156645
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 6.5-7.5. Conditional, tissue specific mutants are variably viable and show diverse defects including obesity, diabetes, thermal dysregulation and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Stat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01720:Stat3 APN 11 100903658 missense possibly damaging 0.77
IGL02289:Stat3 APN 11 100905894 missense possibly damaging 0.82
IGL03183:Stat3 APN 11 100902756 missense possibly damaging 0.71
Cunegonde UTSW 11 100898633 missense probably damaging 0.99
Pangloss UTSW 11 100893670 missense possibly damaging 0.92
Stamatios UTSW 11 100893230 missense probably damaging 1.00
Voltaire UTSW 11 100911267 missense probably damaging 0.99
R0143:Stat3 UTSW 11 100895156 missense possibly damaging 0.89
R0395:Stat3 UTSW 11 100889937 splice site probably benign
R0487:Stat3 UTSW 11 100903643 missense probably damaging 1.00
R0589:Stat3 UTSW 11 100908083 missense probably damaging 0.97
R0800:Stat3 UTSW 11 100894155 splice site probably benign
R1393:Stat3 UTSW 11 100888765 splice site probably null
R3819:Stat3 UTSW 11 100898633 missense probably damaging 0.99
R4037:Stat3 UTSW 11 100893125 missense probably damaging 1.00
R4391:Stat3 UTSW 11 100905552 intron probably benign
R4598:Stat3 UTSW 11 100903674 missense probably damaging 1.00
R4637:Stat3 UTSW 11 100893230 missense probably damaging 1.00
R5479:Stat3 UTSW 11 100889888 unclassified probably benign
R5909:Stat3 UTSW 11 100903730 missense probably benign 0.00
R5930:Stat3 UTSW 11 100893670 missense possibly damaging 0.92
R5944:Stat3 UTSW 11 100895105 missense probably damaging 1.00
R6002:Stat3 UTSW 11 100903743 missense probably benign 0.01
R6431:Stat3 UTSW 11 100889574 missense possibly damaging 0.79
R6816:Stat3 UTSW 11 100911267 missense probably damaging 0.99
X0033:Stat3 UTSW 11 100893092 missense probably benign
Z1176:Stat3 UTSW 11 100911278 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACACTTAGCAACCTGGTCCTG -3'
(R):5'- AGGCTGTCAGTGTCACTCTCTC -3'

Sequencing Primer
(F):5'- TTAGCAACCTGGTCCTGGCATG -3'
(R):5'- AGTGTCACTCTCTCATCCAAGTGG -3'
Posted On2014-07-14