Incidental Mutation 'R1927:Eml1'
ID214976
Institutional Source Beutler Lab
Gene Symbol Eml1
Ensembl Gene ENSMUSG00000058070
Gene Nameechinoderm microtubule associated protein like 1
SynonymsA930030P13Rik, ELP79, 1110008N23Rik
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location108370957-108539617 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 108538217 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 812 (R812*)
Ref Sequence ENSEMBL: ENSMUSP00000105486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054955] [ENSMUST00000109857] [ENSMUST00000109860] [ENSMUST00000130999]
Predicted Effect probably null
Transcript: ENSMUST00000054955
AA Change: R781*
SMART Domains Protein: ENSMUSP00000057209
Gene: ENSMUSG00000058070
AA Change: R781*

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 228 277 5.6e-3 SMART
WD40 280 325 2.21e1 SMART
WD40 328 367 4.46e-1 SMART
WD40 375 413 5.73e0 SMART
WD40 416 456 5.75e-1 SMART
WD40 496 539 4.24e-3 SMART
WD40 542 580 1.37e2 SMART
WD40 583 622 1.7e-2 SMART
WD40 629 668 1.58e-2 SMART
Blast:WD40 694 735 7e-20 BLAST
WD40 741 781 2.96e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109857
AA Change: R798*
SMART Domains Protein: ENSMUSP00000105483
Gene: ENSMUSG00000058070
AA Change: R798*

DomainStartEndE-ValueType
coiled coil region 1 41 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 119 146 N/A INTRINSIC
WD40 245 294 5.6e-3 SMART
WD40 297 342 2.21e1 SMART
WD40 345 384 4.46e-1 SMART
WD40 392 430 5.73e0 SMART
WD40 433 473 5.75e-1 SMART
WD40 513 556 4.24e-3 SMART
WD40 559 597 1.37e2 SMART
WD40 600 639 1.7e-2 SMART
WD40 646 685 1.58e-2 SMART
Blast:WD40 711 752 7e-20 BLAST
WD40 758 798 2.96e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109860
AA Change: R812*
SMART Domains Protein: ENSMUSP00000105486
Gene: ENSMUSG00000058070
AA Change: R812*

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
Pfam:HELP 184 258 1.8e-35 PFAM
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
WD40 660 699 1.58e-2 SMART
Blast:WD40 725 766 7e-20 BLAST
WD40 772 812 2.96e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123035
Predicted Effect probably benign
Transcript: ENSMUST00000130999
SMART Domains Protein: ENSMUSP00000118325
Gene: ENSMUSG00000058070

DomainStartEndE-ValueType
low complexity region 6 18 N/A INTRINSIC
coiled coil region 31 72 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 150 177 N/A INTRINSIC
WD40 259 308 5.6e-3 SMART
WD40 311 356 2.21e1 SMART
WD40 359 398 4.46e-1 SMART
WD40 406 444 5.73e0 SMART
WD40 447 487 5.75e-1 SMART
WD40 527 570 4.24e-3 SMART
WD40 573 611 1.37e2 SMART
WD40 614 653 1.7e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148186
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223178
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Human echinoderm microtubule-associated protein-like is a strong candidate for the Usher syndrome type 1A gene. Usher syndromes (USHs) are a group of genetic disorders consisting of congenital deafness, retinitis pigmentosa, and vestibular dysfunction of variable onset and severity depending on the genetic type. The disease process in USHs involves the entire brain and is not limited to the posterior fossa or auditory and visual systems. The USHs are catagorized as type I (USH1A, USH1B, USH1C, USH1D, USH1E and USH1F), type II (USH2A and USH2B) and type III (USH3). The type I is the most severe form. Gene loci responsible for these three types are all mapped. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit subcortical band heterotopia associated with seizures, developmental delay and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Eml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Eml1 APN 12 108514515 splice site probably null
IGL00774:Eml1 APN 12 108514515 splice site probably null
IGL01358:Eml1 APN 12 108514468 missense probably benign 0.05
IGL02316:Eml1 APN 12 108534759 intron probably benign
IGL02346:Eml1 APN 12 108537441 missense possibly damaging 0.87
IGL02480:Eml1 APN 12 108521696 missense probably benign 0.32
IGL02513:Eml1 APN 12 108530312 missense probably damaging 1.00
IGL02556:Eml1 APN 12 108537366 missense probably benign 0.00
IGL02565:Eml1 APN 12 108506520 missense probably damaging 1.00
IGL03217:Eml1 APN 12 108534942 missense probably benign 0.31
bubble UTSW 12 108513071 critical splice donor site probably null
R0027:Eml1 UTSW 12 108536298 missense possibly damaging 0.90
R0067:Eml1 UTSW 12 108463527 missense possibly damaging 0.61
R0124:Eml1 UTSW 12 108506608 missense probably benign 0.00
R0124:Eml1 UTSW 12 108509178 missense probably damaging 1.00
R0730:Eml1 UTSW 12 108530326 missense possibly damaging 0.79
R1566:Eml1 UTSW 12 108471892 missense probably damaging 0.99
R1883:Eml1 UTSW 12 108463652 missense probably damaging 0.97
R1938:Eml1 UTSW 12 108521396 missense possibly damaging 0.75
R2070:Eml1 UTSW 12 108512999 missense probably damaging 1.00
R2311:Eml1 UTSW 12 108537416 missense probably damaging 0.99
R2417:Eml1 UTSW 12 108536275 missense probably benign 0.00
R3120:Eml1 UTSW 12 108513053 missense probably benign 0.31
R4352:Eml1 UTSW 12 108534837 intron probably benign
R4471:Eml1 UTSW 12 108506635 intron probably benign
R4655:Eml1 UTSW 12 108534713 missense probably damaging 1.00
R5077:Eml1 UTSW 12 108506612 splice site probably benign
R5094:Eml1 UTSW 12 108536311 missense probably benign 0.11
R5113:Eml1 UTSW 12 108537337 missense possibly damaging 0.74
R5524:Eml1 UTSW 12 108521376 missense probably damaging 0.99
R5775:Eml1 UTSW 12 108506554 missense probably damaging 1.00
R6120:Eml1 UTSW 12 108527724 missense probably damaging 1.00
R6224:Eml1 UTSW 12 108514508 missense probably damaging 1.00
R6491:Eml1 UTSW 12 108513071 critical splice donor site probably null
R7035:Eml1 UTSW 12 108509234 missense probably damaging 1.00
R7134:Eml1 UTSW 12 108506551 missense probably benign 0.00
R7273:Eml1 UTSW 12 108538173 missense possibly damaging 0.87
R7606:Eml1 UTSW 12 108537366 missense probably benign 0.45
R7744:Eml1 UTSW 12 108516604 missense probably benign
R7820:Eml1 UTSW 12 108515174 missense possibly damaging 0.81
R8013:Eml1 UTSW 12 108521679 missense probably benign 0.18
R8223:Eml1 UTSW 12 108536310 missense probably benign 0.00
R8258:Eml1 UTSW 12 108510199 missense probably damaging 0.97
R8259:Eml1 UTSW 12 108510199 missense probably damaging 0.97
R8399:Eml1 UTSW 12 108538131 missense possibly damaging 0.91
R8427:Eml1 UTSW 12 108530321 missense probably damaging 0.99
Z1088:Eml1 UTSW 12 108537459 missense possibly damaging 0.80
Z1177:Eml1 UTSW 12 108423139 start gained probably benign
Z1177:Eml1 UTSW 12 108534656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTGCACACAAAGCTGAC -3'
(R):5'- CACACAACCGCTTATCTGGTG -3'

Sequencing Primer
(F):5'- ACGGAGTTTTAGACTGATTTAGTGC -3'
(R):5'- AACCGCTTATCTGGTGTGACAC -3'
Posted On2014-07-14