Incidental Mutation 'R1927:Rtp1'
ID214993
Institutional Source Beutler Lab
Gene Symbol Rtp1
Ensembl Gene ENSMUSG00000033383
Gene Namereceptor transporter protein 1
SynonymsLOC239766, LOC385871
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R1927 (G1)
Quality Score199
Status Not validated
Chromosome16
Chromosomal Location23429133-23433960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23431209 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 108 (I108N)
Ref Sequence ENSEMBL: ENSMUSP00000043416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038730]
Predicted Effect probably damaging
Transcript: ENSMUST00000038730
AA Change: I108N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043416
Gene: ENSMUSG00000033383
AA Change: I108N

DomainStartEndE-ValueType
zf-3CxxC 87 197 3.5e-39 SMART
transmembrane domain 235 257 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility and abnormal olfactory bulb development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Rtp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02276:Rtp1 APN 16 23431313 missense probably benign 0.07
IGL02329:Rtp1 APN 16 23431193 missense probably damaging 1.00
IGL02432:Rtp1 APN 16 23431404 missense probably damaging 1.00
IGL02690:Rtp1 APN 16 23431382 missense probably damaging 1.00
IGL03046:Rtp1 UTSW 16 23429294 missense probably benign 0.30
P0028:Rtp1 UTSW 16 23429366 missense probably damaging 1.00
R0319:Rtp1 UTSW 16 23431460 missense probably damaging 1.00
R0377:Rtp1 UTSW 16 23431284 missense probably damaging 0.98
R0972:Rtp1 UTSW 16 23431308 missense probably damaging 0.99
R1498:Rtp1 UTSW 16 23431220 missense probably benign 0.00
R1751:Rtp1 UTSW 16 23431374 missense probably damaging 0.98
R1767:Rtp1 UTSW 16 23431374 missense probably damaging 0.98
R1900:Rtp1 UTSW 16 23429299 missense probably benign
R1921:Rtp1 UTSW 16 23431410 missense probably damaging 1.00
R1922:Rtp1 UTSW 16 23431410 missense probably damaging 1.00
R2102:Rtp1 UTSW 16 23431358 missense probably benign 0.04
R5118:Rtp1 UTSW 16 23431535 missense probably benign 0.00
R5484:Rtp1 UTSW 16 23429275 missense probably benign
R5614:Rtp1 UTSW 16 23431190 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCTGGGAGACTGCTCTTGTC -3'
(R):5'- TGCTCTCGCAAACTGGTGATG -3'

Sequencing Primer
(F):5'- TCCTGGGGAAACTAATGGACCC -3'
(R):5'- CAAACTGGTGATGAGGTTGTCCAC -3'
Posted On2014-07-14