Incidental Mutation 'R1927:Sema6b'
ID 214997
Institutional Source Beutler Lab
Gene Symbol Sema6b
Ensembl Gene ENSMUSG00000001227
Gene Name sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B
Synonyms Sema, Seman, semaZ, VIb
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock # R1927 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 56123085-56140343 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56132797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 15 (F15I)
Ref Sequence ENSEMBL: ENSMUSP00000130985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001256] [ENSMUST00000167545]
AlphaFold O54951
Predicted Effect probably benign
Transcript: ENSMUST00000001256
AA Change: F15I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000001256
Gene: ENSMUSG00000001227
AA Change: F15I

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167545
AA Change: F15I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000130985
Gene: ENSMUSG00000001227
AA Change: F15I

DomainStartEndE-ValueType
low complexity region 13 21 N/A INTRINSIC
Sema 66 496 2.48e-177 SMART
PSI 527 581 4.09e-1 SMART
transmembrane domain 604 626 N/A INTRINSIC
low complexity region 655 685 N/A INTRINSIC
low complexity region 707 718 N/A INTRINSIC
low complexity region 739 760 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the semaphorin family, a group of proteins characterized by the presence of a conserved semaphorin (sema) domain. Whereas some semaphorins are transmembrane proteins, others are secreted. Semaphorins play a major role in axon guidance. The protein encoded by this gene may be involved in both peripheral and central nervous system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mossy fiber and mossy cell axon projections, thickened suprapyramidal bundles, and elongated infrapyramydal bundles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Sema6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Sema6b APN 17 56130048 missense probably damaging 1.00
IGL01102:Sema6b APN 17 56132761 missense possibly damaging 0.91
IGL01533:Sema6b APN 17 56129499 splice site probably benign
IGL01611:Sema6b APN 17 56129969 splice site probably null
IGL01996:Sema6b APN 17 56131157 missense probably damaging 1.00
IGL02118:Sema6b APN 17 56132821 missense probably benign
R0010:Sema6b UTSW 17 56124105 missense probably benign 0.06
R0066:Sema6b UTSW 17 56128271 missense possibly damaging 0.83
R0066:Sema6b UTSW 17 56128271 missense possibly damaging 0.83
R0525:Sema6b UTSW 17 56126630 missense probably damaging 0.96
R0635:Sema6b UTSW 17 56129971 critical splice donor site probably null
R1129:Sema6b UTSW 17 56124347 missense probably benign
R2211:Sema6b UTSW 17 56124741 missense probably benign 0.00
R4081:Sema6b UTSW 17 56128307 missense probably damaging 0.99
R5013:Sema6b UTSW 17 56132497 critical splice donor site probably null
R5296:Sema6b UTSW 17 56127091 critical splice acceptor site probably null
R5314:Sema6b UTSW 17 56128413 nonsense probably null
R6317:Sema6b UTSW 17 56124047 missense probably benign 0.26
R6419:Sema6b UTSW 17 56132784 nonsense probably null
R7255:Sema6b UTSW 17 56125336 missense probably benign 0.01
R7289:Sema6b UTSW 17 56125573 missense possibly damaging 0.77
R7805:Sema6b UTSW 17 56131555 missense probably damaging 1.00
R8157:Sema6b UTSW 17 56128448 missense probably damaging 1.00
R8290:Sema6b UTSW 17 56124803 missense possibly damaging 0.93
R8305:Sema6b UTSW 17 56127084 missense probably damaging 1.00
R9502:Sema6b UTSW 17 56132500 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGCTCAAGTCTAAGGGAGG -3'
(R):5'- CATGTGGTCTTAAAGTCGCTTG -3'

Sequencing Primer
(F):5'- CTCAAGTCTAAGGGAGGGAGTG -3'
(R):5'- CCCTACCGGCTTATTATGA -3'
Posted On 2014-07-14