Incidental Mutation 'R1927:Slc22a29'
ID214998
Institutional Source Beutler Lab
Gene Symbol Slc22a29
Ensembl Gene ENSMUSG00000075044
Gene Namesolute carrier family 22. member 29
SynonymsD630002G06Rik
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8160165-8218900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8207066 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 257 (I257T)
Ref Sequence ENSEMBL: ENSMUSP00000152815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113298] [ENSMUST00000222533]
Predicted Effect probably benign
Transcript: ENSMUST00000113298
AA Change: I257T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000108923
Gene: ENSMUSG00000075044
AA Change: I257T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.3e-25 PFAM
Pfam:MFS_1 140 372 7.7e-14 PFAM
Pfam:MFS_1 348 549 6.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140910
SMART Domains Protein: ENSMUSP00000117625
Gene: ENSMUSG00000075044

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 98 454 4.6e-20 PFAM
Pfam:MFS_1 137 462 3.6e-15 PFAM
low complexity region 467 481 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149182
SMART Domains Protein: ENSMUSP00000122262
Gene: ENSMUSG00000075044

DomainStartEndE-ValueType
Pfam:Sugar_tr 62 418 2.2e-20 PFAM
Pfam:MFS_1 101 427 1.9e-15 PFAM
low complexity region 431 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222533
AA Change: I257T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sorcs1 G T 19: 50,222,195 P744Q probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Slc22a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc22a29 APN 19 8217813 missense probably benign 0.44
IGL00562:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00563:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00952:Slc22a29 APN 19 8217857 missense probably damaging 1.00
IGL01526:Slc22a29 APN 19 8207178 splice site probably benign
IGL01792:Slc22a29 APN 19 8218529 missense probably damaging 1.00
IGL02191:Slc22a29 APN 19 8218681 unclassified probably benign
IGL02391:Slc22a29 APN 19 8169353 missense probably benign 0.13
IGL02408:Slc22a29 APN 19 8207285 missense probably benign 0.00
IGL02957:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03059:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03299:Slc22a29 APN 19 8162648 critical splice donor site probably null
IGL03368:Slc22a29 APN 19 8207262 critical splice donor site probably null
R0017:Slc22a29 UTSW 19 8218266 splice site probably benign
R0105:Slc22a29 UTSW 19 8160627 unclassified probably benign
R0157:Slc22a29 UTSW 19 8162742 missense possibly damaging 0.61
R0265:Slc22a29 UTSW 19 8169970 missense probably benign 0.18
R1758:Slc22a29 UTSW 19 8217762 critical splice donor site probably null
R1918:Slc22a29 UTSW 19 8217759 splice site probably null
R1959:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1960:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1961:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1966:Slc22a29 UTSW 19 8218408 missense probably damaging 1.00
R1968:Slc22a29 UTSW 19 8218343 missense probably benign 0.27
R1997:Slc22a29 UTSW 19 8217798 missense probably benign 0.00
R3105:Slc22a29 UTSW 19 8169973 missense probably benign 0.25
R3725:Slc22a29 UTSW 19 8218609 missense possibly damaging 0.78
R4118:Slc22a29 UTSW 19 8160529 unclassified probably benign
R4465:Slc22a29 UTSW 19 8162724 nonsense probably null
R4584:Slc22a29 UTSW 19 8169291 missense probably benign 0.02
R4656:Slc22a29 UTSW 19 8218300 missense possibly damaging 0.90
R4679:Slc22a29 UTSW 19 8161584 missense possibly damaging 0.65
R4899:Slc22a29 UTSW 19 8161569 missense probably benign 0.00
R4913:Slc22a29 UTSW 19 8218358 missense probably benign 0.17
R5119:Slc22a29 UTSW 19 8217830 missense probably damaging 0.99
R5470:Slc22a29 UTSW 19 8161516 missense probably benign 0.01
R5474:Slc22a29 UTSW 19 8217857 missense probably damaging 1.00
R6794:Slc22a29 UTSW 19 8161523 missense probably benign 0.06
R6798:Slc22a29 UTSW 19 8160604 missense probably benign 0.16
R7025:Slc22a29 UTSW 19 8160580 missense probably benign
R7240:Slc22a29 UTSW 19 8161511 missense probably damaging 0.98
R7535:Slc22a29 UTSW 19 8169978 missense probably damaging 1.00
R7846:Slc22a29 UTSW 19 8193487 missense probably benign 0.39
R8169:Slc22a29 UTSW 19 8207332 missense probably damaging 1.00
R8275:Slc22a29 UTSW 19 8169317 missense probably benign 0.00
R8403:Slc22a29 UTSW 19 8161640 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCAGAATTCAGTCTCCTCC -3'
(R):5'- GGACCTTGCTCAAACTAAGGTC -3'

Sequencing Primer
(F):5'- TCTCCTCTCCGATAATTGCAAAGAGG -3'
(R):5'- GACCTTGCTCAAACTAAGGTCTTGAC -3'
Posted On2014-07-14