Mutagenetix > Incidental Mutation

Incidental Mutation 'R0128:Hectd4'

21500

Institutional Source

Beutler Lab

Gene Symbol

Hectd4

Ensembl Gene

ENSMUSG00000042744

Gene Name

HECT domain E3 ubiquitin protein ligase 4

Synonyms

Gm15800

MMRRC Submission

038413-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.923) question?

Stock #

R0128 (G1)

Quality Score

203

Status

Validated (trace)

Chromosome

Chromosomal Location

121220219-121368577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121349243 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 3434 (Y3434H)

Ref Sequence

ENSEMBL: ENSMUSP00000048345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042614]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042614
AA Change: Y3434H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: Y3434H

Domain	Start	End	E-Value	Type
low complexity region	224	234	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	725	735	N/A	INTRINSIC
low complexity region	1252	1265	N/A	INTRINSIC
coiled coil region	1372	1398	N/A	INTRINSIC
low complexity region	1551	1562	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1892	1904	N/A	INTRINSIC
low complexity region	2656	2666	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC
low complexity region	2901	2917	N/A	INTRINSIC
low complexity region	2921	2933	N/A	INTRINSIC
low complexity region	3232	3246	N/A	INTRINSIC
low complexity region	3275	3335	N/A	INTRINSIC
low complexity region	3441	3448	N/A	INTRINSIC
low complexity region	3473	3506	N/A	INTRINSIC
low complexity region	3512	3533	N/A	INTRINSIC
low complexity region	3540	3554	N/A	INTRINSIC
low complexity region	3794	3822	N/A	INTRINSIC
HECTc	4048	4412	4.78e-11	SMART

Meta Mutation Damage Score

0.0606

Coding Region Coverage

1x: 99.0%
3x: 97.6%
10x: 93.0%
20x: 79.3%

Validation Efficiency

99% (84/85)

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,575,639		probably benign	Het
Abcd4	T	G	12: 84,612,352	Q210P	possibly damaging	Het
Ablim2	G	A	5: 35,809,176		probably benign	Het
Actl6b	A	G	5: 137,555,065	N113S	probably benign	Het
Actn3	A	T	19: 4,871,615	V179E	probably damaging	Het
Aff4	C	A	11: 53,415,466	T1145N	probably damaging	Het
Ankrd42	G	A	7: 92,591,859	Q431*	probably null	Het
Anxa9	A	G	3: 95,302,422	S129P	probably benign	Het
Arfgef2	T	G	2: 166,835,719	I88S	probably damaging	Het
Asap3	C	A	4: 136,234,604	N285K	probably damaging	Het
Atp6v0a2	A	G	5: 124,713,184	N477S	probably damaging	Het
Atp7b	C	T	8: 22,028,172	E205K	possibly damaging	Het
Atp8b5	T	A	4: 43,369,715		probably null	Het
C87436	G	A	6: 86,469,827	G533D	probably damaging	Het
Ccdc138	T	A	10: 58,528,360	I314N	probably damaging	Het
Ccs	A	G	19: 4,825,626	F237S	probably damaging	Het
Ccz1	T	G	5: 144,009,294		probably benign	Het
Cdcp2	C	T	4: 107,106,707		probably benign	Het
Chd1	A	G	17: 17,393,567	N531S	probably damaging	Het
Clptm1	A	T	7: 19,635,007	F476I	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cped1	T	A	6: 22,121,039	Y373N	probably benign	Het
Cr2	A	T	1: 195,166,231	V328D	probably damaging	Het
D630045J12Rik	A	T	6: 38,149,771		probably benign	Het
Dcdc2a	A	T	13: 25,187,672		probably benign	Het
Dlg1	G	T	16: 31,858,065		probably null	Het
Epb41l5	A	C	1: 119,549,902	V705G	possibly damaging	Het
Ergic3	C	A	2: 156,011,140	R43S	possibly damaging	Het
Flnb	T	C	14: 7,901,951	V938A	probably damaging	Het
Frmd4a	T	C	2: 4,604,092	Y928H	probably damaging	Het
Fyn	C	T	10: 39,511,982	T78M	probably benign	Het
Gdap2	A	G	3: 100,201,995	T443A	probably damaging	Het
Ghrl	A	T	6: 113,717,168		probably benign	Het
Gm1141	T	C	X: 71,939,555	C378R	possibly damaging	Het
Gm12166	A	G	11: 46,052,293	M1T	probably null	Het
Gm4787	T	A	12: 81,377,747	K546*	probably null	Het
Gm498	G	T	7: 143,891,755	G178C	probably damaging	Het
Gm6576	C	G	15: 27,026,000		noncoding transcript	Het
Got1	C	T	19: 43,524,377	D27N	probably benign	Het
Gucy2c	C	T	6: 136,704,249	V946I	probably damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Itpr1	A	G	6: 108,471,209		probably benign	Het
Kctd1	G	A	18: 14,974,180	P743S	probably benign	Het
Klhl23	T	C	2: 69,833,966	V553A	probably damaging	Het
Krt24	T	C	11: 99,280,267	D495G	probably damaging	Het
L3hypdh	C	T	12: 72,077,143		probably null	Het
Lipo3	C	T	19: 33,557,106		probably null	Het
Lman2l	G	T	1: 36,424,864	S171*	probably null	Het
Lrp1b	T	C	2: 41,511,508	D378G	probably damaging	Het
Map3k4	T	A	17: 12,248,063	D1104V	probably damaging	Het
Mpeg1	T	C	19: 12,461,223	V15A	probably benign	Het
Narf	C	T	11: 121,250,836	R356C	probably damaging	Het
Nebl	T	A	2: 17,393,023	Q487H	possibly damaging	Het
Olfm5	G	A	7: 104,160,926	A76V	probably benign	Het
Olfr1090	T	C	2: 86,753,887	M284V	probably benign	Het
Olfr339	T	A	2: 36,422,287	D296E	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr656	A	T	7: 104,618,581	I301F	probably damaging	Het
Olfr992	T	A	2: 85,399,961	S191C	probably damaging	Het
Palb2	A	T	7: 122,128,166	Y160*	probably null	Het
Paxip1	C	T	5: 27,744,185		probably benign	Het
Pclo	A	G	5: 14,679,797		probably benign	Het
Pdcd11	G	A	19: 47,119,862	V1223I	probably benign	Het
Pde6c	T	C	19: 38,169,365		probably benign	Het
Prr12	A	G	7: 45,050,039		probably benign	Het
Prss39	T	A	1: 34,502,200		probably benign	Het
Samd5	A	G	10: 9,674,939	W9R	probably damaging	Het
Sfr1	A	G	19: 47,735,018	*320W	probably null	Het
Sh3bp4	A	G	1: 89,145,314	N628S	possibly damaging	Het
Sim1	A	T	10: 50,907,961	I104F	probably damaging	Het
Slc1a3	T	C	15: 8,636,209	M519V	probably benign	Het
Smcp	T	A	3: 92,584,520	T7S	unknown	Het
Sp4	A	G	12: 118,300,816		probably benign	Het
Spag9	T	A	11: 94,093,539	I327N	probably damaging	Het
Thbs4	G	T	13: 92,754,410	H850N	probably benign	Het
Ubap2l	A	T	3: 90,021,373	S478T	possibly damaging	Het
Unc79	A	G	12: 103,088,434		probably benign	Het
Vmn2r85	A	G	10: 130,419,185		probably benign	Het
Wrap73	A	G	4: 154,142,500	D19G	possibly damaging	Het

Other mutations in Hectd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Hectd4	APN	5	121363870	missense	possibly damaging	0.51
IGL00976:Hectd4	APN	5	121349106	missense	probably benign	0.18
IGL01085:Hectd4	APN	5	121331701	missense	probably damaging	1.00
IGL01112:Hectd4	APN	5	121306950	missense	probably benign	0.01
IGL01402:Hectd4	APN	5	121339417	splice site	probably benign
IGL01474:Hectd4	APN	5	121336649	missense	possibly damaging	0.53
IGL01503:Hectd4	APN	5	121318651	missense	probably benign	0.28
IGL01548:Hectd4	APN	5	121364660	missense	possibly damaging	0.71
IGL01656:Hectd4	APN	5	121322700	missense	probably damaging	0.99
IGL01756:Hectd4	APN	5	121344824	missense	probably benign	0.28
IGL01819:Hectd4	APN	5	121328418	missense	possibly damaging	0.85
IGL02080:Hectd4	APN	5	121366606	utr 3 prime	probably benign
IGL02488:Hectd4	APN	5	121292087	missense	probably benign	0.33
IGL02490:Hectd4	APN	5	121318613	missense	possibly damaging	0.82
IGL02558:Hectd4	APN	5	121344785	missense	probably benign	0.28
IGL02626:Hectd4	APN	5	121353881	missense	possibly damaging	0.86
IGL02649:Hectd4	APN	5	121349402	missense	possibly damaging	0.73
IGL02736:Hectd4	APN	5	121342719	missense	possibly damaging	0.73
IGL02861:Hectd4	APN	5	121307004	missense	possibly damaging	0.81
IGL02880:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02889:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02953:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02969:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03031:Hectd4	APN	5	121348794	missense	possibly damaging	0.96
IGL03066:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03160:Hectd4	APN	5	121259879	missense	probably benign
IGL03181:Hectd4	APN	5	121353958	missense	possibly damaging	0.91
IGL03265:Hectd4	APN	5	121259939	splice site	probably benign
IGL03375:Hectd4	APN	5	121328382	missense	possibly damaging	0.72
Achilles	UTSW	5	121307381	nonsense	probably null
agamemnon	UTSW	5	121253858	splice site	probably benign
clymnestra	UTSW	5	121334375	missense	possibly damaging	0.86
hector	UTSW	5	121315437	missense	probably damaging	1.00
helen	UTSW	5	121310663	missense	probably damaging	0.97
Merriwether	UTSW	5	121353551	missense	possibly damaging	0.53
PIT4466001:Hectd4	UTSW	5	121333060	critical splice donor site	probably null
R0018:Hectd4	UTSW	5	121254179	missense	possibly damaging	0.53
R0024:Hectd4	UTSW	5	121308576	missense	possibly damaging	0.92
R0030:Hectd4	UTSW	5	121262588	nonsense	probably null
R0080:Hectd4	UTSW	5	121349372	missense	probably benign	0.18
R0110:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0110:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0115:Hectd4	UTSW	5	121295506	splice site	probably benign
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0132:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0244:Hectd4	UTSW	5	121329605	missense	probably benign	0.33
R0281:Hectd4	UTSW	5	121254251	missense	possibly damaging	0.85
R0329:Hectd4	UTSW	5	121259864	missense	probably benign
R0410:Hectd4	UTSW	5	121286266	missense	possibly damaging	0.86
R0422:Hectd4	UTSW	5	121343082	splice site	probably null
R0442:Hectd4	UTSW	5	121323982	missense	possibly damaging	0.66
R0449:Hectd4	UTSW	5	121364590	splice site	probably null
R0469:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0469:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0481:Hectd4	UTSW	5	121295506	splice site	probably benign
R0510:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0510:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0520:Hectd4	UTSW	5	121331707	missense	possibly damaging	0.53
R0534:Hectd4	UTSW	5	121348476	missense	possibly damaging	0.96
R0603:Hectd4	UTSW	5	121304337	missense	possibly damaging	0.46
R0617:Hectd4	UTSW	5	121343232	splice site	probably benign
R0622:Hectd4	UTSW	5	121348625	missense	possibly damaging	0.53
R0626:Hectd4	UTSW	5	121277824	missense	probably benign	0.18
R0708:Hectd4	UTSW	5	121286463	critical splice donor site	probably null
R0710:Hectd4	UTSW	5	121336628	missense	probably benign	0.08
R0763:Hectd4	UTSW	5	121307033	unclassified	probably benign
R0764:Hectd4	UTSW	5	121286769	missense	possibly damaging	0.46
R1123:Hectd4	UTSW	5	121286736	missense	probably damaging	0.96
R1129:Hectd4	UTSW	5	121310599	missense	possibly damaging	0.66
R1204:Hectd4	UTSW	5	121350485	missense	possibly damaging	0.85
R1237:Hectd4	UTSW	5	121321507	missense	possibly damaging	0.90
R1257:Hectd4	UTSW	5	121318624	nonsense	probably null
R1391:Hectd4	UTSW	5	121353695	missense	possibly damaging	0.96
R1395:Hectd4	UTSW	5	121328513	critical splice donor site	probably null
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1545:Hectd4	UTSW	5	121323956	missense	possibly damaging	0.87
R1553:Hectd4	UTSW	5	121349259	missense	probably benign	0.00
R1572:Hectd4	UTSW	5	121301878	missense	possibly damaging	0.85
R1662:Hectd4	UTSW	5	121317245	missense	probably benign	0.01
R1705:Hectd4	UTSW	5	121298104	missense	probably benign
R1715:Hectd4	UTSW	5	121344818	missense	possibly damaging	0.85
R1728:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1736:Hectd4	UTSW	5	121349530	missense	possibly damaging	0.53
R1768:Hectd4	UTSW	5	121358303	missense	possibly damaging	0.70
R1775:Hectd4	UTSW	5	121291191	splice site	probably benign
R1784:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1843:Hectd4	UTSW	5	121297180	missense	possibly damaging	0.53
R1914:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R1915:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R2024:Hectd4	UTSW	5	121281918	missense	possibly damaging	0.86
R2103:Hectd4	UTSW	5	121355629	missense	probably benign	0.04
R2108:Hectd4	UTSW	5	121333424	missense	possibly damaging	0.72
R2124:Hectd4	UTSW	5	121318639	missense	probably damaging	0.97
R2150:Hectd4	UTSW	5	121253858	splice site	probably benign
R2192:Hectd4	UTSW	5	121315143	missense	possibly damaging	0.46
R2301:Hectd4	UTSW	5	121353537	missense	probably benign	0.18
R2324:Hectd4	UTSW	5	121315437	missense	probably damaging	1.00
R2331:Hectd4	UTSW	5	121320026	missense	probably benign	0.05
R2504:Hectd4	UTSW	5	121220620	missense	unknown
R2504:Hectd4	UTSW	5	121263967	missense	possibly damaging	0.73
R2904:Hectd4	UTSW	5	121292724	splice site	probably benign
R3843:Hectd4	UTSW	5	121259873	missense	possibly damaging	0.72
R3934:Hectd4	UTSW	5	121320101	critical splice donor site	probably null
R3944:Hectd4	UTSW	5	121303525	splice site	probably benign
R4133:Hectd4	UTSW	5	121277834	critical splice donor site	probably null
R4271:Hectd4	UTSW	5	121220504	small deletion	probably benign
R4413:Hectd4	UTSW	5	121350481	missense	possibly damaging	0.53
R4456:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R4489:Hectd4	UTSW	5	121286257	missense	possibly damaging	0.73
R4539:Hectd4	UTSW	5	121314907	nonsense	probably null
R4564:Hectd4	UTSW	5	121350431	missense	probably benign	0.33
R4582:Hectd4	UTSW	5	121286419	missense	possibly damaging	0.53
R4629:Hectd4	UTSW	5	121297203	missense	probably benign	0.01
R4633:Hectd4	UTSW	5	121349216	missense	probably benign	0.33
R4643:Hectd4	UTSW	5	121349055	missense	possibly damaging	0.53
R4679:Hectd4	UTSW	5	121325251	missense	possibly damaging	0.72
R4681:Hectd4	UTSW	5	121303615	missense	possibly damaging	0.86
R4734:Hectd4	UTSW	5	121341977	missense	possibly damaging	0.53
R4739:Hectd4	UTSW	5	121348442	missense	probably benign
R4781:Hectd4	UTSW	5	121306107	critical splice donor site	probably null
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4869:Hectd4	UTSW	5	121322672	missense	possibly damaging	0.46
R4909:Hectd4	UTSW	5	121263891	missense	probably benign	0.18
R4922:Hectd4	UTSW	5	121359315	missense	possibly damaging	0.86
R4925:Hectd4	UTSW	5	121322690	missense	possibly damaging	0.83
R5004:Hectd4	UTSW	5	121328199	splice site	probably null
R5004:Hectd4	UTSW	5	121329565	missense	possibly damaging	0.93
R5129:Hectd4	UTSW	5	121343510	missense	possibly damaging	0.87
R5217:Hectd4	UTSW	5	121353551	missense	possibly damaging	0.53
R5267:Hectd4	UTSW	5	121344824	missense	probably benign	0.28
R5344:Hectd4	UTSW	5	121343676	missense	probably benign	0.28
R5345:Hectd4	UTSW	5	121263974	missense	possibly damaging	0.85
R5347:Hectd4	UTSW	5	121304448	missense	probably benign	0.33
R5360:Hectd4	UTSW	5	121315401	missense	possibly damaging	0.90
R5363:Hectd4	UTSW	5	121310603	missense	probably benign	0.04
R5445:Hectd4	UTSW	5	121266274	missense	probably benign	0.00
R5479:Hectd4	UTSW	5	121306948	missense	probably benign
R5507:Hectd4	UTSW	5	121281101	missense	unknown
R5552:Hectd4	UTSW	5	121342851	missense	possibly damaging	0.96
R5691:Hectd4	UTSW	5	121348815	missense	possibly damaging	0.85
R5745:Hectd4	UTSW	5	121353502	missense	possibly damaging	0.96
R5757:Hectd4	UTSW	5	121348619	missense	possibly damaging	0.72
R5845:Hectd4	UTSW	5	121307524	critical splice donor site	probably null
R5869:Hectd4	UTSW	5	121343225	critical splice donor site	probably null
R5913:Hectd4	UTSW	5	121323974	missense	possibly damaging	0.83
R5920:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R5943:Hectd4	UTSW	5	121322294	missense	probably benign	0.01
R6219:Hectd4	UTSW	5	121308878	missense	possibly damaging	0.92
R6250:Hectd4	UTSW	5	121339498	missense	possibly damaging	0.85
R6301:Hectd4	UTSW	5	121254220	missense	possibly damaging	0.91
R6428:Hectd4	UTSW	5	121350445	missense	possibly damaging	0.53
R6446:Hectd4	UTSW	5	121334375	missense	possibly damaging	0.86
R6453:Hectd4	UTSW	5	121350592	missense	probably damaging	1.00
R6513:Hectd4	UTSW	5	121356196	splice site	probably null
R6540:Hectd4	UTSW	5	121303571	missense	probably benign	0.33
R6706:Hectd4	UTSW	5	121320084	missense	possibly damaging	0.92
R6720:Hectd4	UTSW	5	121307381	nonsense	probably null
R6736:Hectd4	UTSW	5	121277725	missense	possibly damaging	0.86
R6776:Hectd4	UTSW	5	121353511	missense	possibly damaging	0.85
R7033:Hectd4	UTSW	5	121364568	missense	possibly damaging	0.86
R7038:Hectd4	UTSW	5	121299597	missense	possibly damaging	0.90
R7175:Hectd4	UTSW	5	121273629	missense	possibly damaging	0.85
R7180:Hectd4	UTSW	5	121308342	missense	probably benign	0.01
R7234:Hectd4	UTSW	5	121329073	missense	possibly damaging	0.53
R7253:Hectd4	UTSW	5	121314881	missense	possibly damaging	0.66
R7349:Hectd4	UTSW	5	121310663	missense	probably damaging	0.97
R7450:Hectd4	UTSW	5	121281932	missense	probably benign	0.00
R7467:Hectd4	UTSW	5	121323961	missense	possibly damaging	0.66
R7475:Hectd4	UTSW	5	121358133	splice site	probably null
R7482:Hectd4	UTSW	5	121363878	missense	possibly damaging	0.71
R7512:Hectd4	UTSW	5	121297109	missense	possibly damaging	0.72
R7525:Hectd4	UTSW	5	121343665	missense	possibly damaging	0.70
R7559:Hectd4	UTSW	5	121315510	splice site	probably null
R7560:Hectd4	UTSW	5	121254342	missense	possibly damaging	0.53
R7561:Hectd4	UTSW	5	121291225	missense	possibly damaging	0.91
R7576:Hectd4	UTSW	5	121349459	missense	possibly damaging	0.91
R7584:Hectd4	UTSW	5	121318735	missense	possibly damaging	0.83
R7648:Hectd4	UTSW	5	121254371	missense	possibly damaging	0.73
R7663:Hectd4	UTSW	5	121324031	missense	probably benign	0.06
R7692:Hectd4	UTSW	5	121321564	missense	possibly damaging	0.46
R7725:Hectd4	UTSW	5	121220617	missense	unknown
R7731:Hectd4	UTSW	5	121307014	missense	probably benign	0.00
R7732:Hectd4	UTSW	5	121336629	missense	probably benign	0.14
R7782:Hectd4	UTSW	5	121305721	missense	possibly damaging	0.53
R7854:Hectd4	UTSW	5	121329568	missense	probably benign	0.27
R7898:Hectd4	UTSW	5	121331817	missense	probably benign	0.18
R7910:Hectd4	UTSW	5	121254228	missense	possibly damaging	0.86
R7962:Hectd4	UTSW	5	121310629	missense	probably damaging	0.98
R8003:Hectd4	UTSW	5	121339518	missense	possibly damaging	0.85
R8098:Hectd4	UTSW	5	121321398	missense	possibly damaging	0.46
R8110:Hectd4	UTSW	5	121332949	missense	possibly damaging	0.96
R8118:Hectd4	UTSW	5	121286376	missense	probably benign	0.33
R8171:Hectd4	UTSW	5	121318756	missense	possibly damaging	0.82
R8234:Hectd4	UTSW	5	121339544	missense	possibly damaging	0.72
R8289:Hectd4	UTSW	5	121266361	missense	possibly damaging	0.53
R8292:Hectd4	UTSW	5	121317225	missense	possibly damaging	0.66
R8348:Hectd4	UTSW	5	121220256	start gained	probably benign
R8397:Hectd4	UTSW	5	121259894	missense	probably damaging	0.98
R8436:Hectd4	UTSW	5	121308358	missense	possibly damaging	0.90
R8436:Hectd4	UTSW	5	121343147	missense	probably benign	0.00
R8443:Hectd4	UTSW	5	121329109	missense	possibly damaging	0.72
R8448:Hectd4	UTSW	5	121220256	start gained	probably benign
R8516:Hectd4	UTSW	5	121349010	missense	possibly damaging	0.53
R8519:Hectd4	UTSW	5	121304426	nonsense	probably null
R8553:Hectd4	UTSW	5	121353598	missense	possibly damaging	0.73
R8557:Hectd4	UTSW	5	121310651	missense	possibly damaging	0.66
R8725:Hectd4	UTSW	5	121350494	missense	probably damaging	1.00
R8751:Hectd4	UTSW	5	121363775	nonsense	probably null
R8769:Hectd4	UTSW	5	121281873	missense	possibly damaging	0.53
R8803:Hectd4	UTSW	5	121323931	missense	probably benign	0.01
R8887:Hectd4	UTSW	5	121295478	missense	probably benign	0.44
R8982:Hectd4	UTSW	5	121328242	missense	probably benign	0.02
R8988:Hectd4	UTSW	5	121277756	missense	possibly damaging	0.86
R8991:Hectd4	UTSW	5	121358284	missense	probably benign	0.33
R8994:Hectd4	UTSW	5	121303566	missense	probably benign	0.33
R8995:Hectd4	UTSW	5	121254359	missense	possibly damaging	0.96
R9049:Hectd4	UTSW	5	121313892	missense	possibly damaging	0.92
R9093:Hectd4	UTSW	5	121273614	missense	probably benign	0.14
R9106:Hectd4	UTSW	5	121329556	missense	possibly damaging	0.53
R9137:Hectd4	UTSW	5	121358175	missense	possibly damaging	0.53
R9146:Hectd4	UTSW	5	121349034	missense	probably benign	0.33
R9154:Hectd4	UTSW	5	121253904	missense
R9162:Hectd4	UTSW	5	121306979	missense	possibly damaging	0.66
R9166:Hectd4	UTSW	5	121308627	missense	probably damaging	0.96
R9183:Hectd4	UTSW	5	121299488	missense	possibly damaging	0.51
R9207:Hectd4	UTSW	5	121295433	missense	possibly damaging	0.86
R9291:Hectd4	UTSW	5	121348965	missense	probably benign	0.14
R9300:Hectd4	UTSW	5	121348889	missense	probably benign	0.33
R9314:Hectd4	UTSW	5	121299645	critical splice donor site	probably null
R9381:Hectd4	UTSW	5	121334429	missense	possibly damaging	0.53
R9432:Hectd4	UTSW	5	121322801	missense	probably benign	0.01
R9491:Hectd4	UTSW	5	121314918	missense	probably damaging	0.97
R9532:Hectd4	UTSW	5	121364553	missense	probably benign	0.00
R9557:Hectd4	UTSW	5	121321554	missense	possibly damaging	0.66
R9561:Hectd4	UTSW	5	121334469	missense	possibly damaging	0.53
R9593:Hectd4	UTSW	5	121286781	nonsense	probably null
R9704:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9705:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9712:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9713:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9726:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9732:Hectd4	UTSW	5	121254191	nonsense	probably null
R9750:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121334352	missense	possibly damaging	0.85
R9772:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
X0026:Hectd4	UTSW	5	121349637	missense	probably benign	0.04
X0027:Hectd4	UTSW	5	121321404	missense	probably benign	0.27
Z1088:Hectd4	UTSW	5	121295503	splice site	probably null
Z1177:Hectd4	UTSW	5	121358320	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCAAGCCTGAGGACATGCTG -3'
(R):5'- TCTGTGAGACACACTGTGAACTGC -3'

Sequencing Primer
(F):5'- GACATGCTGTGGTTCCACC -3'
(R):5'- AGGCGCTGATGCTCATGG -3'

Posted On

2013-04-11