Incidental Mutation 'R1927:Sorcs1'
ID215001
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Namesortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 039945-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1927 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location50143299-50678646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 50222195 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 744 (P744Q)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
Predicted Effect probably damaging
Transcript: ENSMUST00000072685
AA Change: P744Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: P744Q

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111756
AA Change: P744Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: P744Q

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164039
AA Change: P744Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: P744Q

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209413
AA Change: P744Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209783
AA Change: P744Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000211008
AA Change: P744Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000211687
AA Change: P744Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,636,379 S31P probably damaging Het
Abca12 G T 1: 71,244,840 H2524Q probably damaging Het
Acsl5 T C 19: 55,278,154 V135A probably benign Het
Actl11 T G 9: 107,929,537 L353R possibly damaging Het
Adcy6 G T 15: 98,598,498 probably null Het
B230104I21Rik A G 4: 154,341,237 I697T probably damaging Het
BC061237 G A 14: 44,501,243 R33K possibly damaging Het
Brf1 C A 12: 113,000,344 V5F possibly damaging Het
Chmp2a C T 7: 13,033,936 A21T possibly damaging Het
Cwh43 A G 5: 73,453,074 N607S probably benign Het
Ddhd2 G A 8: 25,741,661 L445F possibly damaging Het
Dicer1 C A 12: 104,702,884 D1180Y possibly damaging Het
Dock5 A T 14: 67,846,062 S133T possibly damaging Het
Dyx1c1 A T 9: 72,960,627 I57L probably damaging Het
Efs A T 14: 54,917,163 C540S possibly damaging Het
Ehd4 C T 2: 120,091,492 G428S probably benign Het
Eml1 C T 12: 108,538,217 R812* probably null Het
Enpp1 C T 10: 24,654,888 D557N possibly damaging Het
Fn3krp A G 11: 121,424,977 T65A probably damaging Het
Galnt5 A G 2: 57,998,603 R72G probably benign Het
Gfod1 C T 13: 43,200,860 R213H possibly damaging Het
Gm10518 A G 1: 179,803,645 probably benign Het
Gm5431 A G 11: 48,889,255 F558S probably damaging Het
Got1 C T 19: 43,515,680 probably null Het
Gucy2g C T 19: 55,237,759 V242I probably benign Het
Hdgfl2 T A 17: 56,099,874 V606E possibly damaging Het
Hoxa3 T C 6: 52,169,999 probably benign Het
Iqub T A 6: 24,491,671 I339L probably benign Het
Kdm4c C T 4: 74,345,483 T668I probably benign Het
Klhl32 T C 4: 24,617,474 I592V probably benign Het
Mfsd12 G T 10: 81,362,087 M296I probably benign Het
Mfsd4b4 C T 10: 39,892,441 A219T probably damaging Het
Mrpl52 T C 14: 54,426,957 S9P possibly damaging Het
Nbr1 A G 11: 101,567,214 Y273C possibly damaging Het
Ncf4 G T 15: 78,260,646 G217V probably damaging Het
Neo1 T C 9: 58,990,385 E96G probably benign Het
Nid2 T A 14: 19,768,276 N279K probably damaging Het
Nr5a2 A G 1: 136,944,994 Y56H probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nynrin A G 14: 55,863,592 T280A probably benign Het
Olfr1364 A G 13: 21,574,256 F67L probably benign Het
Olfr1367 T A 13: 21,346,946 I6N probably benign Het
Olfr1463 T C 19: 13,235,029 Y260H probably damaging Het
Olfr545 A G 7: 102,494,059 S239P possibly damaging Het
Olfr97 A G 17: 37,231,543 Y276H probably damaging Het
Otog G A 7: 46,246,283 C107Y probably damaging Het
Ptprn A G 1: 75,254,122 V565A probably benign Het
Rbm6 T G 9: 107,852,903 D182A probably damaging Het
Rhbg A G 3: 88,244,552 F400L probably benign Het
Rpl22l1 T A 3: 28,806,589 N33K possibly damaging Het
Rtp1 T A 16: 23,431,209 I108N probably damaging Het
Sema6b A T 17: 56,132,797 F15I probably benign Het
Sirpa C T 2: 129,616,376 T304I possibly damaging Het
Slc22a29 A G 19: 8,207,066 I257T probably benign Het
Slc41a1 T C 1: 131,841,200 I256T probably damaging Het
Smg6 A G 11: 75,142,848 K1208R probably damaging Het
Sptbn5 T C 2: 120,070,462 T213A probably benign Het
St18 A G 1: 6,802,712 T224A probably benign Het
Stat3 T C 11: 100,894,829 N465S probably damaging Het
Stmn2 T A 3: 8,545,576 M40K probably benign Het
Tespa1 A G 10: 130,348,239 D63G probably benign Het
Thrb T A 14: 18,008,674 C133S probably damaging Het
Tmem25 C T 9: 44,796,483 V172M possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trhde T A 10: 114,800,849 Y151F probably damaging Het
Trp53bp2 A G 1: 182,452,664 T912A probably damaging Het
Unc79 C A 12: 103,169,692 A2269E probably damaging Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp758 T G 17: 22,375,842 S436R probably damaging Het
Zfp791 G T 8: 85,110,683 T184K probably benign Het
Znrf3 A G 11: 5,281,062 V817A probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R7950:Sorcs1 UTSW 19 50230260 nonsense probably null
R7992:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGTTATAGGAAAACAAGTCCGG -3'
(R):5'- GCATCAAAAGGGGAATATTGGTTC -3'

Sequencing Primer
(F):5'- ACAAGTCCGGTGTATGATCAG -3'
(R):5'- AGAAGTTGGTTGTCAACTAC -3'
Posted On2014-07-14