Mutagenetix > Incidental Mutation

Incidental Mutation 'R0128:Atp6v0a2'

21501

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

038413-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R0128 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 124713184 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 477 (N477S)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: N477S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: N477S

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197087

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199526

Meta Mutation Damage Score

0.3584

Coding Region Coverage

1x: 99.0%
3x: 97.6%
10x: 93.0%
20x: 79.3%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,575,639		probably benign	Het
Abcd4	T	G	12: 84,612,352	Q210P	possibly damaging	Het
Ablim2	G	A	5: 35,809,176		probably benign	Het
Actl6b	A	G	5: 137,555,065	N113S	probably benign	Het
Actn3	A	T	19: 4,871,615	V179E	probably damaging	Het
Aff4	C	A	11: 53,415,466	T1145N	probably damaging	Het
Ankrd42	G	A	7: 92,591,859	Q431*	probably null	Het
Anxa9	A	G	3: 95,302,422	S129P	probably benign	Het
Arfgef2	T	G	2: 166,835,719	I88S	probably damaging	Het
Asap3	C	A	4: 136,234,604	N285K	probably damaging	Het
Atp7b	C	T	8: 22,028,172	E205K	possibly damaging	Het
Atp8b5	T	A	4: 43,369,715		probably null	Het
C87436	G	A	6: 86,469,827	G533D	probably damaging	Het
Ccdc138	T	A	10: 58,528,360	I314N	probably damaging	Het
Ccs	A	G	19: 4,825,626	F237S	probably damaging	Het
Ccz1	T	G	5: 144,009,294		probably benign	Het
Cdcp2	C	T	4: 107,106,707		probably benign	Het
Chd1	A	G	17: 17,393,567	N531S	probably damaging	Het
Clptm1	A	T	7: 19,635,007	F476I	probably damaging	Het
Colec12	C	T	18: 9,858,921	P568L	unknown	Het
Cped1	T	A	6: 22,121,039	Y373N	probably benign	Het
Cr2	A	T	1: 195,166,231	V328D	probably damaging	Het
D630045J12Rik	A	T	6: 38,149,771		probably benign	Het
Dcdc2a	A	T	13: 25,187,672		probably benign	Het
Dlg1	G	T	16: 31,858,065		probably null	Het
Epb41l5	A	C	1: 119,549,902	V705G	possibly damaging	Het
Ergic3	C	A	2: 156,011,140	R43S	possibly damaging	Het
Flnb	T	C	14: 7,901,951	V938A	probably damaging	Het
Frmd4a	T	C	2: 4,604,092	Y928H	probably damaging	Het
Fyn	C	T	10: 39,511,982	T78M	probably benign	Het
Gdap2	A	G	3: 100,201,995	T443A	probably damaging	Het
Ghrl	A	T	6: 113,717,168		probably benign	Het
Gm1141	T	C	X: 71,939,555	C378R	possibly damaging	Het
Gm12166	A	G	11: 46,052,293	M1T	probably null	Het
Gm4787	T	A	12: 81,377,747	K546*	probably null	Het
Gm498	G	T	7: 143,891,755	G178C	probably damaging	Het
Gm6576	C	G	15: 27,026,000		noncoding transcript	Het
Got1	C	T	19: 43,524,377	D27N	probably benign	Het
Gucy2c	C	T	6: 136,704,249	V946I	probably damaging	Het
Hectd4	T	C	5: 121,349,243	Y3434H	possibly damaging	Het
Hp1bp3	C	T	4: 138,237,209	S348F	probably damaging	Het
Itpr1	A	G	6: 108,471,209		probably benign	Het
Kctd1	G	A	18: 14,974,180	P743S	probably benign	Het
Klhl23	T	C	2: 69,833,966	V553A	probably damaging	Het
Krt24	T	C	11: 99,280,267	D495G	probably damaging	Het
L3hypdh	C	T	12: 72,077,143		probably null	Het
Lipo3	C	T	19: 33,557,106		probably null	Het
Lman2l	G	T	1: 36,424,864	S171*	probably null	Het
Lrp1b	T	C	2: 41,511,508	D378G	probably damaging	Het
Map3k4	T	A	17: 12,248,063	D1104V	probably damaging	Het
Mpeg1	T	C	19: 12,461,223	V15A	probably benign	Het
Narf	C	T	11: 121,250,836	R356C	probably damaging	Het
Nebl	T	A	2: 17,393,023	Q487H	possibly damaging	Het
Olfm5	G	A	7: 104,160,926	A76V	probably benign	Het
Olfr1090	T	C	2: 86,753,887	M284V	probably benign	Het
Olfr339	T	A	2: 36,422,287	D296E	probably benign	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr656	A	T	7: 104,618,581	I301F	probably damaging	Het
Olfr992	T	A	2: 85,399,961	S191C	probably damaging	Het
Palb2	A	T	7: 122,128,166	Y160*	probably null	Het
Paxip1	C	T	5: 27,744,185		probably benign	Het
Pclo	A	G	5: 14,679,797		probably benign	Het
Pdcd11	G	A	19: 47,119,862	V1223I	probably benign	Het
Pde6c	T	C	19: 38,169,365		probably benign	Het
Prr12	A	G	7: 45,050,039		probably benign	Het
Prss39	T	A	1: 34,502,200		probably benign	Het
Samd5	A	G	10: 9,674,939	W9R	probably damaging	Het
Sfr1	A	G	19: 47,735,018	*320W	probably null	Het
Sh3bp4	A	G	1: 89,145,314	N628S	possibly damaging	Het
Sim1	A	T	10: 50,907,961	I104F	probably damaging	Het
Slc1a3	T	C	15: 8,636,209	M519V	probably benign	Het
Smcp	T	A	3: 92,584,520	T7S	unknown	Het
Sp4	A	G	12: 118,300,816		probably benign	Het
Spag9	T	A	11: 94,093,539	I327N	probably damaging	Het
Thbs4	G	T	13: 92,754,410	H850N	probably benign	Het
Ubap2l	A	T	3: 90,021,373	S478T	possibly damaging	Het
Unc79	A	G	12: 103,088,434		probably benign	Het
Vmn2r85	A	G	10: 130,419,185		probably benign	Het
Wrap73	A	G	4: 154,142,500	D19G	possibly damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4013:Atp6v0a2	UTSW	5	124712796	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAAGCCAGTCACAGGAGGTAATGC -3'
(R):5'- TGGTGCTGTCACTGAAACAGAGGG -3'

Sequencing Primer
(F):5'- GCTGGAATGAGCCATTATGATCC -3'
(R):5'- TCACTGAAACAGAGGGCAGAG -3'

Posted On

2013-04-11