Incidental Mutation 'R1928:Thbs3'
ID215023
Institutional Source Beutler Lab
Gene Symbol Thbs3
Ensembl Gene ENSMUSG00000028047
Gene Namethrombospondin 3
SynonymsThbs-3, TSP3
MMRRC Submission 039946-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.767) question?
Stock #R1928 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location89215180-89226837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89217760 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 52 (R52L)
Ref Sequence ENSEMBL: ENSMUSP00000116136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000073572] [ENSMUST00000118964] [ENSMUST00000119084] [ENSMUST00000142051] [ENSMUST00000152789] [ENSMUST00000174126]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029682
AA Change: R121L

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047
AA Change: R121L

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073572
SMART Domains Protein: ENSMUSP00000073261
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 4.2e-21 PFAM
Pfam:Tom37_C 239 317 8.1e-24 PFAM
Pfam:GST_C_3 267 383 1.7e-11 PFAM
Pfam:GST_C_2 270 377 2.7e-8 PFAM
Pfam:Tom37_C 300 369 1.1e-14 PFAM
low complexity region 396 415 N/A INTRINSIC
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118964
SMART Domains Protein: ENSMUSP00000114009
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
low complexity region 94 109 N/A INTRINSIC
Pfam:Tom37 151 219 5.9e-21 PFAM
Pfam:Tom37_C 216 287 6.3e-19 PFAM
Pfam:GST_C_3 216 352 5.1e-11 PFAM
Pfam:GST_C_2 238 344 1.9e-8 PFAM
Pfam:Tom37_C 269 338 9.5e-15 PFAM
low complexity region 365 384 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119084
AA Change: R121L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047
AA Change: R121L

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119222
SMART Domains Protein: ENSMUSP00000113986
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 12 57 1.6e-11 PFAM
Pfam:Tom37_C 138 216 5.4e-24 PFAM
Pfam:GST_C_3 166 282 1.1e-11 PFAM
Pfam:GST_C_2 169 276 1.8e-8 PFAM
Pfam:Tom37_C 199 268 7.2e-15 PFAM
low complexity region 295 314 N/A INTRINSIC
transmembrane domain 315 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126700
Predicted Effect probably damaging
Transcript: ENSMUST00000142051
AA Change: R52L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116136
Gene: ENSMUSG00000028047
AA Change: R52L

DomainStartEndE-ValueType
TSPN 1 124 2.52e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150303
Predicted Effect probably benign
Transcript: ENSMUST00000152789
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156847
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173239
Predicted Effect probably benign
Transcript: ENSMUST00000173465
Predicted Effect probably benign
Transcript: ENSMUST00000173477
SMART Domains Protein: ENSMUSP00000133282
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 1 58 8.5e-16 PFAM
Pfam:Tom37_C 77 155 9.7e-24 PFAM
Pfam:GST_C_3 104 221 8.2e-12 PFAM
Pfam:GST_C_2 107 216 7.5e-9 PFAM
Pfam:Tom37_C 138 207 1.3e-14 PFAM
low complexity region 234 253 N/A INTRINSIC
transmembrane domain 254 276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173593
SMART Domains Protein: ENSMUSP00000133866
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37 14 82 1.1e-21 PFAM
Pfam:Tom37_C 102 178 3.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199915
Meta Mutation Damage Score 0.1803 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice at a young age are heavier and exhibit femurs with increased periosteal and endocortical diameters, greater moments of inertia and increased bending strength and failure loads, with these defects no longer detected in older mice. Femoral heads show accelerated bone ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Gramd1b C T 9: 40,306,469 M595I possibly damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Grin2b A G 6: 136,044,046 C86R probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Invs A G 4: 48,390,095 Y251C probably damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Muc4 A T 16: 32,750,532 S137C probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Synj2 T A 17: 5,990,267 I121N probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wdr77 C T 3: 105,967,302 P337S probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zcchc6 A G 13: 59,816,734 L209P probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Thbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Thbs3 APN 3 89219058 nonsense probably null
IGL02927:Thbs3 APN 3 89220207 missense probably damaging 0.98
IGL02980:Thbs3 UTSW 3 89223144 missense probably benign
R0648:Thbs3 UTSW 3 89216665 intron probably null
R0690:Thbs3 UTSW 3 89220165 missense possibly damaging 0.50
R1856:Thbs3 UTSW 3 89226406 missense probably damaging 1.00
R2116:Thbs3 UTSW 3 89219392 missense probably damaging 1.00
R4600:Thbs3 UTSW 3 89224590 missense probably damaging 0.97
R4719:Thbs3 UTSW 3 89216840 missense probably damaging 1.00
R4947:Thbs3 UTSW 3 89226431 missense probably damaging 1.00
R4989:Thbs3 UTSW 3 89223102 intron probably benign
R5134:Thbs3 UTSW 3 89223102 intron probably benign
R5217:Thbs3 UTSW 3 89223164 critical splice donor site probably null
R5305:Thbs3 UTSW 3 89217976 intron probably benign
R5354:Thbs3 UTSW 3 89221377 missense probably damaging 1.00
R5444:Thbs3 UTSW 3 89223385 intron probably benign
R5569:Thbs3 UTSW 3 89219463 missense probably damaging 1.00
R5646:Thbs3 UTSW 3 89219098 missense probably damaging 1.00
R5801:Thbs3 UTSW 3 89224397 missense probably benign 0.15
R5886:Thbs3 UTSW 3 89220163 missense probably damaging 1.00
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6943:Thbs3 UTSW 3 89224864 missense probably benign 0.01
R7017:Thbs3 UTSW 3 89224415 missense probably damaging 1.00
R7352:Thbs3 UTSW 3 89225280 missense probably benign 0.03
R7570:Thbs3 UTSW 3 89219052 nonsense probably null
R7671:Thbs3 UTSW 3 89216707 missense probably benign 0.01
R7707:Thbs3 UTSW 3 89224900 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGTGCACCTGTTACATACAAGG -3'
(R):5'- CCTGCATCCTCAGATAAGCC -3'

Sequencing Primer
(F):5'- GTGAGTTCCAGTATACTCAGAGC -3'
(R):5'- GCATCCTCAGATAAGCCTTTTG -3'
Posted On2014-07-14