Incidental Mutation 'R1928:Wdr77'
ID215024
Institutional Source Beutler Lab
Gene Symbol Wdr77
Ensembl Gene ENSMUSG00000000561
Gene NameWD repeat domain 77
Synonyms2610003I18Rik, 2610312E17Rik, p44/MEP50
MMRRC Submission 039946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1928 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105959369-105970037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105967302 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 337 (P337S)
Ref Sequence ENSEMBL: ENSMUSP00000010278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010278] [ENSMUST00000128005] [ENSMUST00000130994]
Predicted Effect probably benign
Transcript: ENSMUST00000010278
AA Change: P337S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000010278
Gene: ENSMUSG00000000561
AA Change: P337S

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
WD40 70 107 5.11e1 SMART
WD40 115 153 1.06e-3 SMART
WD40 156 196 4.51e-7 SMART
WD40 201 241 2.75e1 SMART
WD40 244 284 9.94e-1 SMART
WD40 286 326 1.99e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127464
Predicted Effect probably benign
Transcript: ENSMUST00000128005
SMART Domains Protein: ENSMUSP00000122465
Gene: ENSMUSG00000000561

DomainStartEndE-ValueType
WD40 13 51 1.06e-3 SMART
WD40 54 94 4.51e-7 SMART
WD40 99 139 2.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130994
SMART Domains Protein: ENSMUSP00000120517
Gene: ENSMUSG00000000561

DomainStartEndE-ValueType
PDB:4GQB|B 1 52 8e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Meta Mutation Damage Score 0.0687 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an androgen receptor coactivator that forms a complex with protein arginine methyltransferase 5, which modifies specific arginines to dimethylarginines in several spliceosomal Sm proteins. The encoded protein may be involved in the early stages of prostate cancer, with most of the protein being nuclear-localized in benign cells but cytoplasmic in cancer cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die prior to E8.5 for unknown reasons. Heterozygotes develop multifocal hyperplasia in the dorsal prostate; however, no prostate tumors are detected up to 12 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Gramd1b C T 9: 40,306,469 M595I possibly damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Grin2b A G 6: 136,044,046 C86R probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Invs A G 4: 48,390,095 Y251C probably damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Muc4 A T 16: 32,750,532 S137C probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Synj2 T A 17: 5,990,267 I121N probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Thbs3 G T 3: 89,217,760 R52L probably damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zcchc6 A G 13: 59,816,734 L209P probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Wdr77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Wdr77 APN 3 105959686 nonsense probably null
R0368:Wdr77 UTSW 3 105962066 critical splice donor site probably null
R0436:Wdr77 UTSW 3 105960026 missense probably damaging 1.00
R1403:Wdr77 UTSW 3 105967257 missense possibly damaging 0.76
R1403:Wdr77 UTSW 3 105967257 missense possibly damaging 0.76
R2422:Wdr77 UTSW 3 105960021 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAATCTAACACCCACTGGCCTG -3'
(R):5'- TCACTATGGGATGCAGCCTC -3'

Sequencing Primer
(F):5'- TAACACCCACTGGCCTGGTAATG -3'
(R):5'- ATGCAGCCTCCCTCAGG -3'
Posted On2014-07-14