Incidental Mutation 'R1928:Invs'
ID 215028
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Name inversin
Synonyms
MMRRC Submission 039946-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.690) question?
Stock # R1928 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 48279760-48431954 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48390095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 251 (Y251C)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030029
AA Change: Y251C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: Y251C

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129480
Predicted Effect probably damaging
Transcript: ENSMUST00000143433
AA Change: Y195C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: Y195C

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Meta Mutation Damage Score 0.2141 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Gramd1b C T 9: 40,306,469 M595I possibly damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Grin2b A G 6: 136,044,046 C86R probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Muc4 A T 16: 32,750,532 S137C probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Synj2 T A 17: 5,990,267 I121N probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Thbs3 G T 3: 89,217,760 R52L probably damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wdr77 C T 3: 105,967,302 P337S probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zcchc6 A G 13: 59,816,734 L209P probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48402909 missense probably damaging 0.98
IGL00487:Invs APN 4 48407689 nonsense probably null
IGL01487:Invs APN 4 48398136 missense probably benign 0.26
IGL01696:Invs APN 4 48425997 missense probably damaging 1.00
IGL02238:Invs APN 4 48390029 missense probably damaging 1.00
IGL03286:Invs APN 4 48382261 missense probably benign 0.26
R0645:Invs UTSW 4 48407653 missense probably benign 0.00
R0661:Invs UTSW 4 48421861 missense probably benign
R0698:Invs UTSW 4 48396364 missense probably benign 0.04
R0763:Invs UTSW 4 48392628 missense possibly damaging 0.82
R1183:Invs UTSW 4 48421725 missense possibly damaging 0.68
R1381:Invs UTSW 4 48421942 nonsense probably null
R1511:Invs UTSW 4 48382148 missense possibly damaging 0.82
R1843:Invs UTSW 4 48422035 missense probably damaging 0.96
R1903:Invs UTSW 4 48402824 splice site probably null
R1990:Invs UTSW 4 48392599 missense possibly damaging 0.88
R2063:Invs UTSW 4 48396287 missense probably damaging 1.00
R2064:Invs UTSW 4 48396287 missense probably damaging 1.00
R2065:Invs UTSW 4 48396287 missense probably damaging 1.00
R2066:Invs UTSW 4 48396287 missense probably damaging 1.00
R4744:Invs UTSW 4 48397609 missense probably damaging 1.00
R4997:Invs UTSW 4 48396332 missense probably damaging 0.98
R5011:Invs UTSW 4 48421807 missense probably damaging 1.00
R5013:Invs UTSW 4 48421807 missense probably damaging 1.00
R5083:Invs UTSW 4 48396307 missense possibly damaging 0.90
R5184:Invs UTSW 4 48283242 utr 5 prime probably benign
R5258:Invs UTSW 4 48396374 missense possibly damaging 0.82
R5375:Invs UTSW 4 48385262 missense probably benign 0.12
R5509:Invs UTSW 4 48396337 missense probably damaging 1.00
R5560:Invs UTSW 4 48416084 missense probably benign 0.00
R5748:Invs UTSW 4 48307823 missense probably damaging 0.98
R5813:Invs UTSW 4 48398146 missense probably damaging 0.98
R5840:Invs UTSW 4 48396284 missense probably damaging 1.00
R5984:Invs UTSW 4 48421674 missense probably benign 0.00
R6513:Invs UTSW 4 48397534 missense possibly damaging 0.46
R6637:Invs UTSW 4 48416203 splice site probably null
R6667:Invs UTSW 4 48402870 missense possibly damaging 0.66
R6838:Invs UTSW 4 48283278 missense possibly damaging 0.95
R6921:Invs UTSW 4 48396260 missense possibly damaging 0.46
R6945:Invs UTSW 4 48421785 missense probably benign 0.00
R7102:Invs UTSW 4 48407674 missense probably benign 0.21
R7142:Invs UTSW 4 48407696 missense probably damaging 1.00
R7263:Invs UTSW 4 48396381 missense probably damaging 1.00
R7283:Invs UTSW 4 48392526 splice site probably null
R7461:Invs UTSW 4 48392668 missense probably damaging 1.00
R7503:Invs UTSW 4 48396347 missense probably damaging 0.96
R7581:Invs UTSW 4 48421909 missense probably benign 0.00
R7613:Invs UTSW 4 48392668 missense probably damaging 1.00
R7861:Invs UTSW 4 48397559 missense possibly damaging 0.50
R8316:Invs UTSW 4 48426199 missense possibly damaging 0.68
R8321:Invs UTSW 4 48283267 missense probably benign 0.13
R8500:Invs UTSW 4 48422109 missense probably damaging 1.00
R8544:Invs UTSW 4 48397598 missense probably damaging 0.96
R9171:Invs UTSW 4 48398149 missense possibly damaging 0.90
R9663:Invs UTSW 4 48426218 missense probably damaging 1.00
X0026:Invs UTSW 4 48398221 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AACGTGCAGGTTTCGTTTTAAG -3'
(R):5'- GGAGCCGGGTTATGAGATAATC -3'

Sequencing Primer
(F):5'- AAGCATATTTATTGAGGGTTCTGC -3'
(R):5'- CCGGGTTATGAGATAATCGAGCATAG -3'
Posted On 2014-07-14