Incidental Mutation 'R1928:Grin2b'
ID215047
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 039946-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1928 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136044046 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 86 (C86R)
Ref Sequence ENSEMBL: ENSMUSP00000142696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905] [ENSMUST00000125905] [ENSMUST00000143943] [ENSMUST00000152012] [ENSMUST00000188999]
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: C86R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: C86R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: C86R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: C86R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125905
Predicted Effect probably benign
Transcript: ENSMUST00000143943
Predicted Effect probably damaging
Transcript: ENSMUST00000152012
AA Change: C86R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142696
Gene: ENSMUSG00000030209
AA Change: C86R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 66 312 1.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188999
Meta Mutation Damage Score 0.9160 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Gramd1b C T 9: 40,306,469 M595I possibly damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Invs A G 4: 48,390,095 Y251C probably damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Muc4 A T 16: 32,750,532 S137C probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Synj2 T A 17: 5,990,267 I121N probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Thbs3 G T 3: 89,217,760 R52L probably damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wdr77 C T 3: 105,967,302 P337S probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zcchc6 A G 13: 59,816,734 L209P probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTGGTGCACGTCTATCTTTAAC -3'
(R):5'- GCAAAGCTCGTTCCCAAAAG -3'

Sequencing Primer
(F):5'- GTGCACGTCTATCTTTAACTACTTAG -3'
(R):5'- TCGTTCCCAAAAGAGCGC -3'
Posted On2014-07-14