Incidental Mutation 'R1928:Gramd1b'
ID215070
Institutional Source Beutler Lab
Gene Symbol Gramd1b
Ensembl Gene ENSMUSG00000040111
Gene NameGRAM domain containing 1B
SynonymsA930008A22Rik
MMRRC Submission 039946-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1928 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location40293233-40531383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40306469 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 595 (M595I)
Ref Sequence ENSEMBL: ENSMUSP00000130050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045682] [ENSMUST00000118159] [ENSMUST00000119373] [ENSMUST00000121357] [ENSMUST00000165104] [ENSMUST00000211853] [ENSMUST00000216821]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045682
AA Change: M595I

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048126
Gene: ENSMUSG00000040111
AA Change: M595I

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
low complexity region 123 141 N/A INTRINSIC
low complexity region 203 226 N/A INTRINSIC
GRAM 240 307 1.54e-28 SMART
low complexity region 375 385 N/A INTRINSIC
Pfam:DUF4782 519 667 1.6e-38 PFAM
low complexity region 696 710 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118159
AA Change: M411I

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112417
Gene: ENSMUSG00000040111
AA Change: M411I

DomainStartEndE-ValueType
low complexity region 19 42 N/A INTRINSIC
GRAM 56 123 1.54e-28 SMART
low complexity region 191 201 N/A INTRINSIC
low complexity region 512 526 N/A INTRINSIC
transmembrane domain 584 606 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000119373
AA Change: M478I
SMART Domains Protein: ENSMUSP00000112489
Gene: ENSMUSG00000040111
AA Change: M478I

DomainStartEndE-ValueType
low complexity region 9 24 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
GRAM 126 193 1.54e-28 SMART
low complexity region 261 271 N/A INTRINSIC
low complexity region 582 596 N/A INTRINSIC
transmembrane domain 654 676 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121357
AA Change: M447I

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112564
Gene: ENSMUSG00000040111
AA Change: M447I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 55 78 N/A INTRINSIC
GRAM 92 159 1.54e-28 SMART
low complexity region 227 237 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
transmembrane domain 620 642 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137454
AA Change: M205I
SMART Domains Protein: ENSMUSP00000116871
Gene: ENSMUSG00000040111
AA Change: M205I

DomainStartEndE-ValueType
Pfam:DUF4782 130 278 2.3e-39 PFAM
low complexity region 307 321 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155265
Predicted Effect possibly damaging
Transcript: ENSMUST00000165104
AA Change: M595I

PolyPhen 2 Score 0.703 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130050
Gene: ENSMUSG00000040111
AA Change: M595I

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
low complexity region 123 141 N/A INTRINSIC
low complexity region 203 226 N/A INTRINSIC
GRAM 240 307 1.54e-28 SMART
low complexity region 375 385 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211853
AA Change: M480I

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000216821
AA Change: M451I

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.1354 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Grin2b A G 6: 136,044,046 C86R probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Invs A G 4: 48,390,095 Y251C probably damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Muc4 A T 16: 32,750,532 S137C probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Synj2 T A 17: 5,990,267 I121N probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Thbs3 G T 3: 89,217,760 R52L probably damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wdr77 C T 3: 105,967,302 P337S probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zcchc6 A G 13: 59,816,734 L209P probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Gramd1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Gramd1b APN 9 40310041 missense probably damaging 0.97
IGL00575:Gramd1b APN 9 40327411 splice site probably benign
IGL01596:Gramd1b APN 9 40303513 missense probably damaging 1.00
IGL01810:Gramd1b APN 9 40315773 missense probably damaging 1.00
IGL02148:Gramd1b APN 9 40315764 missense probably damaging 1.00
IGL02206:Gramd1b APN 9 40300032 missense probably benign 0.01
IGL02626:Gramd1b APN 9 40298010 missense probably damaging 0.98
IGL02723:Gramd1b APN 9 40306831 missense probably damaging 0.97
IGL03192:Gramd1b APN 9 40306801 missense probably damaging 1.00
I2288:Gramd1b UTSW 9 40306805 missense probably damaging 0.97
PIT4283001:Gramd1b UTSW 9 40455456 missense probably benign 0.01
R0038:Gramd1b UTSW 9 40317526 missense probably damaging 1.00
R0038:Gramd1b UTSW 9 40317526 missense probably damaging 1.00
R0600:Gramd1b UTSW 9 40308355 missense probably damaging 1.00
R1290:Gramd1b UTSW 9 40316821 intron probably null
R1637:Gramd1b UTSW 9 40304538 splice site probably null
R1782:Gramd1b UTSW 9 40413337 missense probably damaging 1.00
R3620:Gramd1b UTSW 9 40455546 missense probably benign 0.01
R3943:Gramd1b UTSW 9 40531044 start codon destroyed probably null
R4613:Gramd1b UTSW 9 40307993 missense probably damaging 1.00
R4740:Gramd1b UTSW 9 40315832 intron probably null
R4808:Gramd1b UTSW 9 40304349 missense possibly damaging 0.58
R5407:Gramd1b UTSW 9 40455655 missense probably damaging 0.97
R6209:Gramd1b UTSW 9 40333650 missense probably damaging 1.00
R6797:Gramd1b UTSW 9 40308406 missense probably benign 0.34
R7103:Gramd1b UTSW 9 40401606 missense unknown
R7185:Gramd1b UTSW 9 40333563 missense probably benign 0.03
R7352:Gramd1b UTSW 9 40307993 missense probably damaging 1.00
R7409:Gramd1b UTSW 9 40327431 missense probably damaging 1.00
R7561:Gramd1b UTSW 9 40401615 missense unknown
R8272:Gramd1b UTSW 9 40304524 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACCGACACAAGCCTTTG -3'
(R):5'- TTGGAAATGCTGTCACATCATG -3'

Sequencing Primer
(F):5'- TTTGCACAGCACACCTGAGTC -3'
(R):5'- CTACTTGGGAAGATGCCAATGAATC -3'
Posted On2014-07-14