Mutagenetix > Incidental Mutation

Incidental Mutation 'R1928:Zfyve26'

215087

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, LOC380767, 9330197E15Rik

MMRRC Submission

039946-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79232346-79296304 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 79239970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Stop codon at position 2281 (W2281*)

Ref Sequence

ENSEMBL: ENSMUSP00000021547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377]

AlphaFold

Q5DU37

Predicted Effect

probably null
Transcript: ENSMUST00000021547
AA Change: W2281*

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: W2281*

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218377

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218433

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218447

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219105

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220092

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220390

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

98% (120/123)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	T	G	6: 132,626,601	Q64P	unknown	Het
Adgrv1	A	T	13: 81,520,786	F1830L	probably benign	Het
Anks3	C	T	16: 4,946,054		probably null	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
B4galnt4	C	T	7: 141,068,148	R526*	probably null	Het
Best2	A	G	8: 85,011,253	F171S	probably benign	Het
C2cd5	A	T	6: 143,013,230	V965D	probably damaging	Het
Cd33	T	C	7: 43,529,879	E282G	probably benign	Het
Cep95	C	T	11: 106,790,728		probably benign	Het
Chd6	A	T	2: 160,968,000		probably benign	Het
Clec4d	A	T	6: 123,267,161		probably null	Het
Cntd1	C	T	11: 101,283,852	S128L	probably damaging	Het
Col19a1	T	C	1: 24,451,754		probably benign	Het
Ctrb1	C	A	8: 111,688,692	V117L	probably benign	Het
Dclk1	T	C	3: 55,247,521	V124A	possibly damaging	Het
Dcp2	T	C	18: 44,405,571		probably null	Het
Dctn1	C	A	6: 83,199,184		probably benign	Het
E330009J07Rik	A	G	6: 40,411,714	F238L	probably benign	Het
Ephb3	T	A	16: 21,222,295	M701K	possibly damaging	Het
Ero1lb	A	G	13: 12,601,759	E359G	probably damaging	Het
Exosc8	G	T	3: 54,728,845	A255E	probably damaging	Het
Fam155a	T	C	8: 9,770,217	T268A	probably benign	Het
Fam160a1	G	A	3: 85,688,531	P349L	probably damaging	Het
Fndc3c1	C	T	X: 106,433,522	A824T	probably benign	Het
Gja10	G	A	4: 32,601,812	Q191*	probably null	Het
Gm1587	C	T	14: 77,798,848	R6Q	unknown	Het
Gm3409	A	G	5: 146,539,608	I190V	probably benign	Het
Gm4952	G	T	19: 12,623,609	M64I	probably damaging	Het
Gramd1b	C	T	9: 40,306,469	M595I	possibly damaging	Het
Grik1	C	T	16: 88,051,353	V176M	probably damaging	Het
Grin2b	A	G	6: 136,044,046	C86R	probably damaging	Het
Gtse1	C	T	15: 85,862,063		probably benign	Het
Hectd2	T	C	19: 36,612,319	Y615H	probably damaging	Het
Hydin	T	C	8: 110,502,947	F1552S	possibly damaging	Het
Ifi207	A	G	1: 173,729,645	V516A	possibly damaging	Het
Igfbp5	G	T	1: 72,874,025	P39T	probably damaging	Het
Il23r	T	A	6: 67,423,735	D537V	possibly damaging	Het
Invs	A	G	4: 48,390,095	Y251C	probably damaging	Het
Isl1	G	T	13: 116,308,417	H25Q	probably damaging	Het
Kif13a	A	G	13: 46,812,745	L399P	probably damaging	Het
Klhl1	A	G	14: 96,346,789	V335A	probably benign	Het
Klhl14	C	A	18: 21,651,786	A195S	probably damaging	Het
Lepr	A	G	4: 101,782,730		probably benign	Het
Map1b	A	C	13: 99,430,946	S1756A	unknown	Het
Med23	C	T	10: 24,909,812	A877V	probably benign	Het
Mfsd4b2	T	C	10: 39,921,462	Y299C	probably damaging	Het
Mipol1	T	A	12: 57,332,419	M221K	probably damaging	Het
Muc4	A	T	16: 32,750,532	S137C	probably damaging	Het
Mutyh	T	C	4: 116,816,658	Y189H	probably damaging	Het
Nabp2	T	C	10: 128,409,313	T21A	possibly damaging	Het
Nell1	T	A	7: 50,701,195	V530E	possibly damaging	Het
Npc1	G	C	18: 12,213,378	P254A	possibly damaging	Het
Nup153	A	G	13: 46,701,026	V530A	probably damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr16	T	C	1: 172,957,314	V173A	probably damaging	Het
Olfr747	A	G	14: 50,681,415	V73A	probably benign	Het
Olfr873	T	C	9: 20,301,058	V287A	probably benign	Het
Pabpc1l	T	A	2: 164,032,254	I193N	possibly damaging	Het
Pabpc4l	A	G	3: 46,446,631	Y193H	probably damaging	Het
Pank1	T	C	19: 34,878,881	S66G	probably benign	Het
Pcdhb1	A	T	18: 37,266,180	K395*	probably null	Het
Pcna	A	G	2: 132,251,897		probably benign	Het
Pgr	T	A	9: 8,903,629	Y550*	probably null	Het
Phf11a	A	G	14: 59,281,867		probably benign	Het
Pkhd1	A	T	1: 20,081,300		probably benign	Het
Pofut2	T	A	10: 77,260,808	Y122*	probably null	Het
Pole	A	G	5: 110,327,778	M1818V	probably benign	Het
Rapgef3	A	G	15: 97,750,033	L696P	probably damaging	Het
Rasal3	T	C	17: 32,397,353	D310G	probably damaging	Het
Rhoq	A	G	17: 86,995,058	K141E	probably benign	Het
Rilpl1	A	G	5: 124,514,750		probably benign	Het
Rnaseh1	T	C	12: 28,653,089	S91P	probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Saa1	C	A	7: 46,742,432	G31W	probably null	Het
Scaf8	A	G	17: 3,168,077	T241A	unknown	Het
Scarb2	C	T	5: 92,444,266	A473T	possibly damaging	Het
Scnn1b	T	C	7: 121,910,447	F273S	probably damaging	Het
Sdccag8	T	C	1: 176,828,970	V136A	probably damaging	Het
Sdr16c6	A	T	4: 4,069,926	V138E	probably damaging	Het
Sf3a3	G	A	4: 124,722,093	A180T	possibly damaging	Het
Slc16a5	T	A	11: 115,470,016	S342T	probably damaging	Het
Slc18a1	A	G	8: 69,073,812	S75P	probably benign	Het
Slc7a6	T	A	8: 106,193,488		probably benign	Het
Smco3	G	A	6: 136,831,847	Q10*	probably null	Het
Spem2	T	C	11: 69,817,464	Q225R	probably benign	Het
Ssb	G	T	2: 69,867,557		probably null	Het
Stx8	T	C	11: 68,109,280	I182T	probably damaging	Het
Synj2	T	A	17: 5,990,267	I121N	probably damaging	Het
Tbc1d1	T	C	5: 64,345,300	Y1055H	probably damaging	Het
Tex45	T	A	8: 3,486,947	I431K	possibly damaging	Het
Thbs3	G	T	3: 89,217,760	R52L	probably damaging	Het
Tmem101	C	T	11: 102,153,396	V222I	probably benign	Het
Tnks2	C	T	19: 36,845,668	Q112*	probably null	Het
Tnrc6b	T	A	15: 80,880,723	W809R	probably damaging	Het
Trib2	T	A	12: 15,815,453	R16S	probably damaging	Het
Trim12a	T	C	7: 104,307,124	N70D	probably damaging	Het
Trim55	T	A	3: 19,661,882		probably null	Het
Tspyl5	T	A	15: 33,687,007	D264V	probably damaging	Het
Ttn	A	G	2: 76,725,044	V30539A	probably damaging	Het
Tubgcp3	A	G	8: 12,663,988	F43S	possibly damaging	Het
Ube2cbp	A	G	9: 86,423,003	L262P	probably damaging	Het
Ugt1a7c	T	C	1: 88,095,929	V270A	probably benign	Het
Vav3	T	A	3: 109,506,422	F225L	possibly damaging	Het
Vmn1r21	G	T	6: 57,844,092	Y122*	probably null	Het
Vmn1r225	C	A	17: 20,502,809	Q171K	probably benign	Het
Vmn2r103	T	C	17: 19,811,767	V601A	possibly damaging	Het
Vmn2r19	T	A	6: 123,331,630	N555K	probably damaging	Het
Vps33a	G	A	5: 123,558,621	A323V	probably benign	Het
Wdr77	C	T	3: 105,967,302	P337S	probably benign	Het
Wnk1	A	T	6: 119,952,923	I93N	probably damaging	Het
Zbtb9	T	A	17: 26,974,638	I339N	probably damaging	Het
Zcchc6	A	G	13: 59,816,734	L209P	probably damaging	Het
Zfp202	T	A	9: 40,209,787	D241E	probably damaging	Het
Zfp235	T	A	7: 24,141,138	Y327*	probably null	Het
Zfp820	A	C	17: 21,819,335	D337E	probably benign	Het
Zfp944	T	C	17: 22,341,084	T14A	probably damaging	Het
Zfy1	A	G	Y: 729,733	V303A	unknown	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79249460	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79280900	missense	probably benign
IGL01148:Zfyve26	APN	12	79260870	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79252183	splice site	probably null
IGL01472:Zfyve26	APN	12	79276343	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79244373	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79287851	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79261574	splice site	probably null
IGL01689:Zfyve26	APN	12	79284053	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79287444	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79244400	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79276395	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79268847	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79280080	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79239020	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79263870	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79261791	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79295564	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79284072	nonsense	probably null
challenge	UTSW	12	79270836	critical splice donor site	probably null
fourteener	UTSW	12	79255263	missense	probably damaging	1.00
IGL02799:Zfyve26	UTSW	12	79273310	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79276281	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79244484	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79246222	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79268728	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79265802	splice site	probably benign
R0738:Zfyve26	UTSW	12	79295534	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79273598	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79272127	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79263949	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79274920	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79282817	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79252163	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79252151	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79287761	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79238944	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79278463	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79269049	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79286258	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79264351	missense	probably damaging	1.00
R1982:Zfyve26	UTSW	12	79255243	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79284032	splice site	probably null
R2071:Zfyve26	UTSW	12	79287446	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79246052	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79246087	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79275040	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79284116	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79282799	splice site	probably null
R3084:Zfyve26	UTSW	12	79265683	splice site	probably benign
R3086:Zfyve26	UTSW	12	79265683	splice site	probably benign
R4626:Zfyve26	UTSW	12	79269070	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79244396	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79249695	splice site	probably null
R4926:Zfyve26	UTSW	12	79275011	missense	probably benign
R4990:Zfyve26	UTSW	12	79287833	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79280385	nonsense	probably null
R5029:Zfyve26	UTSW	12	79286323	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79255361	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79280058	nonsense	probably null
R5252:Zfyve26	UTSW	12	79268982	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79270850	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79246521	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79239924	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79273373	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79264357	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79287737	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79266537	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79293854	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79268727	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79249599	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79282984	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79240002	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79238335	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79266449	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79284152	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79279114	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79280405	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79268408	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79246171	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79278372	splice site	probably null
R7299:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79251168	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79240054	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79287807	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79268676	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79290957	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79268635	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79280355	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79255324	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79268557	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79280836	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79260831	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79255263	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79287680	missense	probably damaging	0.99
R8686:Zfyve26	UTSW	12	79287453	missense	probably benign
R8758:Zfyve26	UTSW	12	79264309	critical splice donor site	probably benign
R8826:Zfyve26	UTSW	12	79238968	missense	probably benign	0.05
R8877:Zfyve26	UTSW	12	79287378	missense	probably benign	0.05
R9067:Zfyve26	UTSW	12	79272141	missense	probably damaging	0.99
R9195:Zfyve26	UTSW	12	79264394	missense	probably benign	0.12
R9269:Zfyve26	UTSW	12	79276302	missense	possibly damaging	0.73
R9273:Zfyve26	UTSW	12	79270836	critical splice donor site	probably null
R9340:Zfyve26	UTSW	12	79274906	nonsense	probably null
R9348:Zfyve26	UTSW	12	79268457	missense	possibly damaging	0.81
R9482:Zfyve26	UTSW	12	79244465	missense	probably damaging	1.00
R9536:Zfyve26	UTSW	12	79251272	missense	probably benign	0.32
R9653:Zfyve26	UTSW	12	79287644	missense	probably benign
R9676:Zfyve26	UTSW	12	79284185	missense	probably benign	0.01
R9797:Zfyve26	UTSW	12	79246232	missense	probably damaging	0.98
RF010:Zfyve26	UTSW	12	79255338	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79239005	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79268533	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79287375	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGTAGCATGTGATCTTAATTCC -3'
(R):5'- AAGGCCTGCTGTGACTTCTC -3'

Sequencing Primer
(F):5'- CCTCAGTTTACAGGTTGTAGCAGAC -3'
(R):5'- GCTGTGACTTCTCATGACAAAC -3'

Posted On

2014-07-14