Mutagenetix > Incidental Mutation

Incidental Mutation 'R1928:Muc4'

215106

Institutional Source

Beutler Lab

Gene Symbol

Muc4

Ensembl Gene

ENSMUSG00000079620

Gene Name

mucin 4

Synonyms

4933405I11Rik

MMRRC Submission

039946-MU

Accession Numbers

Genbank: NM_080457; MGI: 2153525

Essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R1928 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32735886-32782391 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32750532 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Cysteine at position 137 (S137C)

Ref Sequence

ENSEMBL: ENSMUSP00000093813 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000132475]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000096106
AA Change: S137C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: S137C

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
low complexity region	37	65	N/A	INTRINSIC
low complexity region	86	111	N/A	INTRINSIC
internal_repeat_2	119	903	6.07e-127	PROSPERO
internal_repeat_1	164	987	3.47e-144	PROSPERO
internal_repeat_2	979	1875	6.07e-127	PROSPERO
internal_repeat_1	1193	2087	3.47e-144	PROSPERO
low complexity region	2090	2106	N/A	INTRINSIC
low complexity region	2111	2119	N/A	INTRINSIC
low complexity region	2186	2195	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2324	2332	N/A	INTRINSIC
low complexity region	2344	2367	N/A	INTRINSIC
NIDO	2458	2615	8.33e-67	SMART
AMOP	2614	2726	1.29e-47	SMART
VWD	2729	2910	4.23e-26	SMART
EGF_like	3134	3166	3.23e1	SMART
EGF_like	3176	3212	3.5e1	SMART
low complexity region	3237	3251	N/A	INTRINSIC
EGF	3384	3421	1.4e0	SMART
transmembrane domain	3430	3452	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132475
AA Change: S199C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000119029
Gene: ENSMUSG00000079620
AA Change: S199C

Domain	Start	End	E-Value	Type
low complexity region	38	45	N/A	INTRINSIC
low complexity region	72	84	N/A	INTRINSIC
low complexity region	99	127	N/A	INTRINSIC
low complexity region	148	173	N/A	INTRINSIC
low complexity region	192	224	N/A	INTRINSIC
low complexity region	283	293	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142355

Meta Mutation Damage Score

0.1854

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

98% (120/123)

MGI Phenotype

FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 117 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630073D07Rik	T	G	6: 132,626,601	Q64P	unknown	Het
Adgrv1	A	T	13: 81,520,786	F1830L	probably benign	Het
Anks3	C	T	16: 4,946,054		probably null	Het
Aqp12	G	A	1: 93,006,610	D70N	probably damaging	Het
B4galnt4	C	T	7: 141,068,148	R526*	probably null	Het
Best2	A	G	8: 85,011,253	F171S	probably benign	Het
C2cd5	A	T	6: 143,013,230	V965D	probably damaging	Het
Cd33	T	C	7: 43,529,879	E282G	probably benign	Het
Cep95	C	T	11: 106,790,728		probably benign	Het
Chd6	A	T	2: 160,968,000		probably benign	Het
Clec4d	A	T	6: 123,267,161		probably null	Het
Cntd1	C	T	11: 101,283,852	S128L	probably damaging	Het
Col19a1	T	C	1: 24,451,754		probably benign	Het
Ctrb1	C	A	8: 111,688,692	V117L	probably benign	Het
Dclk1	T	C	3: 55,247,521	V124A	possibly damaging	Het
Dcp2	T	C	18: 44,405,571		probably null	Het
Dctn1	C	A	6: 83,199,184		probably benign	Het
E330009J07Rik	A	G	6: 40,411,714	F238L	probably benign	Het
Ephb3	T	A	16: 21,222,295	M701K	possibly damaging	Het
Ero1lb	A	G	13: 12,601,759	E359G	probably damaging	Het
Exosc8	G	T	3: 54,728,845	A255E	probably damaging	Het
Fam155a	T	C	8: 9,770,217	T268A	probably benign	Het
Fam160a1	G	A	3: 85,688,531	P349L	probably damaging	Het
Fndc3c1	C	T	X: 106,433,522	A824T	probably benign	Het
Gja10	G	A	4: 32,601,812	Q191*	probably null	Het
Gm1587	C	T	14: 77,798,848	R6Q	unknown	Het
Gm3409	A	G	5: 146,539,608	I190V	probably benign	Het
Gm4952	G	T	19: 12,623,609	M64I	probably damaging	Het
Gramd1b	C	T	9: 40,306,469	M595I	possibly damaging	Het
Grik1	C	T	16: 88,051,353	V176M	probably damaging	Het
Grin2b	A	G	6: 136,044,046	C86R	probably damaging	Het
Gtse1	C	T	15: 85,862,063		probably benign	Het
Hectd2	T	C	19: 36,612,319	Y615H	probably damaging	Het
Hydin	T	C	8: 110,502,947	F1552S	possibly damaging	Het
Ifi207	A	G	1: 173,729,645	V516A	possibly damaging	Het
Igfbp5	G	T	1: 72,874,025	P39T	probably damaging	Het
Il23r	T	A	6: 67,423,735	D537V	possibly damaging	Het
Invs	A	G	4: 48,390,095	Y251C	probably damaging	Het
Isl1	G	T	13: 116,308,417	H25Q	probably damaging	Het
Kif13a	A	G	13: 46,812,745	L399P	probably damaging	Het
Klhl1	A	G	14: 96,346,789	V335A	probably benign	Het
Klhl14	C	A	18: 21,651,786	A195S	probably damaging	Het
Lepr	A	G	4: 101,782,730		probably benign	Het
Map1b	A	C	13: 99,430,946	S1756A	unknown	Het
Med23	C	T	10: 24,909,812	A877V	probably benign	Het
Mfsd4b2	T	C	10: 39,921,462	Y299C	probably damaging	Het
Mipol1	T	A	12: 57,332,419	M221K	probably damaging	Het
Mutyh	T	C	4: 116,816,658	Y189H	probably damaging	Het
Nabp2	T	C	10: 128,409,313	T21A	possibly damaging	Het
Nell1	T	A	7: 50,701,195	V530E	possibly damaging	Het
Npc1	G	C	18: 12,213,378	P254A	possibly damaging	Het
Nup153	A	G	13: 46,701,026	V530A	probably damaging	Het
Nxpe2	T	C	9: 48,326,614	T114A	probably damaging	Het
Olfr16	T	C	1: 172,957,314	V173A	probably damaging	Het
Olfr747	A	G	14: 50,681,415	V73A	probably benign	Het
Olfr873	T	C	9: 20,301,058	V287A	probably benign	Het
Pabpc1l	T	A	2: 164,032,254	I193N	possibly damaging	Het
Pabpc4l	A	G	3: 46,446,631	Y193H	probably damaging	Het
Pank1	T	C	19: 34,878,881	S66G	probably benign	Het
Pcdhb1	A	T	18: 37,266,180	K395*	probably null	Het
Pcna	A	G	2: 132,251,897		probably benign	Het
Pgr	T	A	9: 8,903,629	Y550*	probably null	Het
Phf11a	A	G	14: 59,281,867		probably benign	Het
Pkhd1	A	T	1: 20,081,300		probably benign	Het
Pofut2	T	A	10: 77,260,808	Y122*	probably null	Het
Pole	A	G	5: 110,327,778	M1818V	probably benign	Het
Rapgef3	A	G	15: 97,750,033	L696P	probably damaging	Het
Rasal3	T	C	17: 32,397,353	D310G	probably damaging	Het
Rhoq	A	G	17: 86,995,058	K141E	probably benign	Het
Rilpl1	A	G	5: 124,514,750		probably benign	Het
Rnaseh1	T	C	12: 28,653,089	S91P	probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Saa1	C	A	7: 46,742,432	G31W	probably null	Het
Scaf8	A	G	17: 3,168,077	T241A	unknown	Het
Scarb2	C	T	5: 92,444,266	A473T	possibly damaging	Het
Scnn1b	T	C	7: 121,910,447	F273S	probably damaging	Het
Sdccag8	T	C	1: 176,828,970	V136A	probably damaging	Het
Sdr16c6	A	T	4: 4,069,926	V138E	probably damaging	Het
Sf3a3	G	A	4: 124,722,093	A180T	possibly damaging	Het
Slc16a5	T	A	11: 115,470,016	S342T	probably damaging	Het
Slc18a1	A	G	8: 69,073,812	S75P	probably benign	Het
Slc7a6	T	A	8: 106,193,488		probably benign	Het
Smco3	G	A	6: 136,831,847	Q10*	probably null	Het
Spem2	T	C	11: 69,817,464	Q225R	probably benign	Het
Ssb	G	T	2: 69,867,557		probably null	Het
Stx8	T	C	11: 68,109,280	I182T	probably damaging	Het
Synj2	T	A	17: 5,990,267	I121N	probably damaging	Het
Tbc1d1	T	C	5: 64,345,300	Y1055H	probably damaging	Het
Tex45	T	A	8: 3,486,947	I431K	possibly damaging	Het
Thbs3	G	T	3: 89,217,760	R52L	probably damaging	Het
Tmem101	C	T	11: 102,153,396	V222I	probably benign	Het
Tnks2	C	T	19: 36,845,668	Q112*	probably null	Het
Tnrc6b	T	A	15: 80,880,723	W809R	probably damaging	Het
Trib2	T	A	12: 15,815,453	R16S	probably damaging	Het
Trim12a	T	C	7: 104,307,124	N70D	probably damaging	Het
Trim55	T	A	3: 19,661,882		probably null	Het
Tspyl5	T	A	15: 33,687,007	D264V	probably damaging	Het
Ttn	A	G	2: 76,725,044	V30539A	probably damaging	Het
Tubgcp3	A	G	8: 12,663,988	F43S	possibly damaging	Het
Ube2cbp	A	G	9: 86,423,003	L262P	probably damaging	Het
Ugt1a7c	T	C	1: 88,095,929	V270A	probably benign	Het
Vav3	T	A	3: 109,506,422	F225L	possibly damaging	Het
Vmn1r21	G	T	6: 57,844,092	Y122*	probably null	Het
Vmn1r225	C	A	17: 20,502,809	Q171K	probably benign	Het
Vmn2r103	T	C	17: 19,811,767	V601A	possibly damaging	Het
Vmn2r19	T	A	6: 123,331,630	N555K	probably damaging	Het
Vps33a	G	A	5: 123,558,621	A323V	probably benign	Het
Wdr77	C	T	3: 105,967,302	P337S	probably benign	Het
Wnk1	A	T	6: 119,952,923	I93N	probably damaging	Het
Zbtb9	T	A	17: 26,974,638	I339N	probably damaging	Het
Zcchc6	A	G	13: 59,816,734	L209P	probably damaging	Het
Zfp202	T	A	9: 40,209,787	D241E	probably damaging	Het
Zfp235	T	A	7: 24,141,138	Y327*	probably null	Het
Zfp820	A	C	17: 21,819,335	D337E	probably benign	Het
Zfp944	T	C	17: 22,341,084	T14A	probably damaging	Het
Zfy1	A	G	Y: 729,733	V303A	unknown	Het
Zfyve26	C	T	12: 79,239,970	W2281*	probably null	Het

Other mutations in Muc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00088:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00089:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00090:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00091:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00092:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL00163:Muc4	APN	16	32754090	missense	probably benign	0.20
IGL00324:Muc4	APN	16	32778812	missense	probably benign	0.03
IGL00331:Muc4	APN	16	32753185	missense	probably benign	0.01
IGL00539:Muc4	APN	16	32750910	missense	possibly damaging	0.53
IGL00590:Muc4	APN	16	32754347	missense	probably benign	0.10
IGL00990:Muc4	APN	16	32753823	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753848	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753849	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753863	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753886	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32752569	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32753955	missense	possibly damaging	0.86
IGL00990:Muc4	APN	16	32754071	missense	probably benign	0.01
IGL00990:Muc4	APN	16	32755805	unclassified	probably benign
IGL01091:Muc4	APN	16	32753927	missense	probably benign	0.04
IGL01124:Muc4	APN	16	32768730	missense	possibly damaging	0.65
IGL01131:Muc4	APN	16	32753901	missense	possibly damaging	0.72
IGL01536:Muc4	APN	16	32763966	missense	possibly damaging	0.93
IGL01603:Muc4	APN	16	32750655	missense	probably benign	0.23
IGL01618:Muc4	APN	16	32756627	missense	unknown
IGL01625:Muc4	APN	16	32755544	unclassified	probably benign
IGL01626:Muc4	APN	16	32736402	missense	possibly damaging	0.48
IGL01653:Muc4	APN	16	32761348	splice site	probably null
IGL01682:Muc4	APN	16	32754086	missense	probably benign	0.35
IGL01870:Muc4	APN	16	32753196	missense	probably benign	0.01
IGL01966:Muc4	APN	16	32751426	missense	possibly damaging	0.84
IGL01973:Muc4	APN	16	32754265	missense	probably benign	0.01
IGL02089:Muc4	APN	16	32751313	missense	possibly damaging	0.83
IGL02152:Muc4	APN	16	32777649	splice site	probably benign
IGL02210:Muc4	APN	16	32752254	missense	probably benign	0.00
IGL02278:Muc4	APN	16	32754529	missense	probably benign	0.01
IGL02280:Muc4	APN	16	32754529	missense	probably benign	0.01
IGL02316:Muc4	APN	16	32750850	missense	possibly damaging	0.73
IGL02351:Muc4	APN	16	32750986	missense	possibly damaging	0.86
IGL02358:Muc4	APN	16	32750986	missense	possibly damaging	0.86
IGL02391:Muc4	APN	16	32752076	missense	probably benign	0.41
IGL02449:Muc4	APN	16	32756129	unclassified	probably benign
IGL02607:Muc4	APN	16	32775819	missense	possibly damaging	0.73
IGL02888:Muc4	APN	16	32755282	unclassified	probably benign
IGL02893:Muc4	APN	16	32751648	missense	possibly damaging	0.68
IGL02902:Muc4	APN	16	32750394	missense	possibly damaging	0.50
IGL03007:Muc4	APN	16	32752048	missense	possibly damaging	0.84
IGL03161:Muc4	APN	16	32751948	missense	possibly damaging	0.84
IGL03304:Muc4	APN	16	32751439	nonsense	probably null
IGL03335:Muc4	APN	16	32753021	missense	probably benign	0.01
IGL03411:Muc4	APN	16	32754318	missense	probably benign	0.01
multisplendored	UTSW	16	32751051	missense	possibly damaging	0.53
protean	UTSW	16	32754689	missense	probably benign	0.00
R0864_muc4_269	UTSW	16	32752002	missense	probably benign	0.01
3-1:Muc4	UTSW	16	32770394	missense	possibly damaging	0.86
3-1:Muc4	UTSW	16	32760251	splice site	probably benign
BB004:Muc4	UTSW	16	32771637	missense
BB014:Muc4	UTSW	16	32771637	missense
IGL02835:Muc4	UTSW	16	32763945	missense	probably benign	0.32
P0035:Muc4	UTSW	16	32760248	splice site	probably benign
PIT4131001:Muc4	UTSW	16	32755684	unclassified	probably benign
PIT4131001:Muc4	UTSW	16	32755699	unclassified	probably benign
PIT4131001:Muc4	UTSW	16	32755676	unclassified	probably benign
PIT4142001:Muc4	UTSW	16	32755676	unclassified	probably benign
PIT4142001:Muc4	UTSW	16	32755684	unclassified	probably benign
PIT4142001:Muc4	UTSW	16	32754529	missense	probably benign	0.01
PIT4366001:Muc4	UTSW	16	32754796	missense	unknown
PIT4531001:Muc4	UTSW	16	32756017	missense	unknown
R0119:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0133:Muc4	UTSW	16	32771604	missense	possibly damaging	0.91
R0136:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0243:Muc4	UTSW	16	32765746	missense	possibly damaging	0.53
R0277:Muc4	UTSW	16	32755690	unclassified	probably benign
R0299:Muc4	UTSW	16	32750195	critical splice acceptor site	probably benign
R0380:Muc4	UTSW	16	32752905	missense	probably benign	0.00
R0462:Muc4	UTSW	16	32762536	missense	possibly damaging	0.93
R0507:Muc4	UTSW	16	32751069	missense	probably benign	0.01
R0508:Muc4	UTSW	16	32751313	missense	possibly damaging	0.83
R0543:Muc4	UTSW	16	32756746	missense	unknown
R0578:Muc4	UTSW	16	32755690	unclassified	probably benign
R0617:Muc4	UTSW	16	32752107	missense	possibly damaging	0.83
R0656:Muc4	UTSW	16	32751670	missense	possibly damaging	0.91
R0726:Muc4	UTSW	16	32769827	missense	probably damaging	0.99
R0727:Muc4	UTSW	16	32769847	missense	probably benign	0.01
R0776:Muc4	UTSW	16	32752220	missense	probably benign	0.04
R0854:Muc4	UTSW	16	32778955	missense	possibly damaging	0.53
R0862:Muc4	UTSW	16	32752002	missense	probably benign	0.01
R0864:Muc4	UTSW	16	32752002	missense	probably benign	0.01
R0926:Muc4	UTSW	16	32756196	unclassified	probably benign
R0990:Muc4	UTSW	16	32752722	missense	probably benign	0.00
R1127:Muc4	UTSW	16	32750525	missense	possibly damaging	0.92
R1203:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R1433:Muc4	UTSW	16	32753020	missense	probably benign	0.00
R1466:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1466:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1506:Muc4	UTSW	16	32752233	missense	possibly damaging	0.59
R1518:Muc4	UTSW	16	32750349	missense	possibly damaging	0.84
R1544:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1584:Muc4	UTSW	16	32753595	missense	probably benign	0.04
R1593:Muc4	UTSW	16	32754686	missense	probably benign	0.00
R1601:Muc4	UTSW	16	32755501	unclassified	probably benign
R1611:Muc4	UTSW	16	32750986	missense	possibly damaging	0.86
R1673:Muc4	UTSW	16	32756902	missense	probably benign	0.11
R1717:Muc4	UTSW	16	32753405	missense	possibly damaging	0.53
R1822:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1824:Muc4	UTSW	16	32755933	unclassified	probably benign
R1839:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R1846:Muc4	UTSW	16	32752369	missense	probably benign	0.01
R1864:Muc4	UTSW	16	32756251	unclassified	probably benign
R1868:Muc4	UTSW	16	32756341	missense	unknown
R1942:Muc4	UTSW	16	32750642	missense	probably damaging	0.99
R2017:Muc4	UTSW	16	32751303	missense	possibly damaging	0.92
R2023:Muc4	UTSW	16	32752254	missense	probably benign	0.00
R2081:Muc4	UTSW	16	32752220	missense	probably benign	0.04
R2088:Muc4	UTSW	16	32756409	missense	unknown
R2121:Muc4	UTSW	16	32760238	missense	unknown
R2139:Muc4	UTSW	16	32761225	missense	unknown
R2158:Muc4	UTSW	16	32754563	missense	probably benign	0.10
R2165:Muc4	UTSW	16	32750476	missense	probably damaging	0.96
R2210:Muc4	UTSW	16	32755176	frame shift	probably null
R2225:Muc4	UTSW	16	32755891	unclassified	probably benign
R2225:Muc4	UTSW	16	32766942	missense	possibly damaging	0.73
R2269:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R2679:Muc4	UTSW	16	32757472	missense	unknown
R3703:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R3816:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R3909:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4014:Muc4	UTSW	16	32755273	unclassified	probably benign
R4065:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4066:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4067:Muc4	UTSW	16	32751051	missense	possibly damaging	0.53
R4245:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4249:Muc4	UTSW	16	32755826	unclassified	probably benign
R4344:Muc4	UTSW	16	32770292	missense	possibly damaging	0.53
R4388:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4393:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R4482:Muc4	UTSW	16	32756701	missense	unknown
R4523:Muc4	UTSW	16	32736336	utr 5 prime	probably benign
R4527:Muc4	UTSW	16	32755843	unclassified	probably benign
R4572:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4587:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4614:Muc4	UTSW	16	32757058	missense	probably benign	0.03
R4635:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4661:Muc4	UTSW	16	32769277	missense	possibly damaging	0.71
R4701:Muc4	UTSW	16	32755846	unclassified	probably benign
R4730:Muc4	UTSW	16	32751214	missense	possibly damaging	0.86
R4740:Muc4	UTSW	16	32775903	missense	possibly damaging	0.91
R4762:Muc4	UTSW	16	32753625	unclassified	probably benign
R4818:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4821:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R4825:Muc4	UTSW	16	32751747	missense	probably benign	0.41
R4830:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R4860:Muc4	UTSW	16	32754625	missense	probably benign	0.18
R4860:Muc4	UTSW	16	32754616	missense	probably benign	0.35
R4869:Muc4	UTSW	16	32754836	unclassified	probably benign
R4934:Muc4	UTSW	16	32756098	unclassified	probably benign
R4959:Muc4	UTSW	16	32754319	missense	possibly damaging	0.73
R4969:Muc4	UTSW	16	32754572	missense	probably benign	0.01
R4995:Muc4	UTSW	16	32754214	missense	probably benign	0.01
R4995:Muc4	UTSW	16	32754041	missense	probably benign	0.01
R4999:Muc4	UTSW	16	32756296	unclassified	probably benign
R5073:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R5075:Muc4	UTSW	16	32754794	unclassified	probably benign
R5152:Muc4	UTSW	16	32757058	nonsense	probably null
R5161:Muc4	UTSW	16	32762521	missense	probably damaging	0.98
R5174:Muc4	UTSW	16	32751738	missense	possibly damaging	0.84
R5268:Muc4	UTSW	16	32751666	missense	possibly damaging	0.83
R5447:Muc4	UTSW	16	32753919	missense	probably benign	0.10
R5474:Muc4	UTSW	16	32761261	missense	unknown
R5567:Muc4	UTSW	16	32777692	missense	possibly damaging	0.72
R5570:Muc4	UTSW	16	32777692	missense	possibly damaging	0.72
R5618:Muc4	UTSW	16	32754253	missense	probably benign	0.01
R5665:Muc4	UTSW	16	32750782	missense	probably benign	0.33
R5667:Muc4	UTSW	16	32753720	missense	probably benign	0.01
R5671:Muc4	UTSW	16	32753720	missense	probably benign	0.01
R5693:Muc4	UTSW	16	32776807	missense	possibly damaging	0.53
R5703:Muc4	UTSW	16	32736241	nonsense	probably null
R5708:Muc4	UTSW	16	32754769	unclassified	probably benign
R5715:Muc4	UTSW	16	32751916	missense	possibly damaging	0.92
R5849:Muc4	UTSW	16	32774839	missense	possibly damaging	0.53
R5873:Muc4	UTSW	16	32751295	missense	possibly damaging	0.61
R5930:Muc4	UTSW	16	32751705	missense	probably benign	0.41
R5933:Muc4	UTSW	16	32753052	missense	probably benign	0.01
R5966:Muc4	UTSW	16	32756278	unclassified	probably benign
R6062:Muc4	UTSW	16	32759308	missense	unknown
R6067:Muc4	UTSW	16	32755247	unclassified	probably benign
R6067:Muc4	UTSW	16	32754529	missense	probably benign	0.01
R6078:Muc4	UTSW	16	32755247	unclassified	probably benign
R6079:Muc4	UTSW	16	32755247	unclassified	probably benign
R6112:Muc4	UTSW	16	32775783	missense	possibly damaging	0.86
R6120:Muc4	UTSW	16	32756795	missense	unknown
R6144:Muc4	UTSW	16	32766924	missense	possibly damaging	0.53
R6148:Muc4	UTSW	16	32753802	missense	probably benign	0.04
R6173:Muc4	UTSW	16	32736140	start gained	probably benign
R6268:Muc4	UTSW	16	32768767	missense	probably damaging	0.99
R6299:Muc4	UTSW	16	32752035	missense	possibly damaging	0.48
R6307:Muc4	UTSW	16	32753946	missense	possibly damaging	0.56
R6354:Muc4	UTSW	16	32754358	missense	probably benign	0.19
R6361:Muc4	UTSW	16	32767351	missense	probably benign	0.32
R6375:Muc4	UTSW	16	32736243	utr 5 prime	probably benign
R6378:Muc4	UTSW	16	32778946	missense	probably benign	0.33
R6418:Muc4	UTSW	16	32751789	missense	possibly damaging	0.68
R6458:Muc4	UTSW	16	32759320	critical splice donor site	probably null
R6527:Muc4	UTSW	16	32753433	missense	probably benign	0.01
R6616:Muc4	UTSW	16	32782008	missense	possibly damaging	0.93
R6636:Muc4	UTSW	16	32753964	missense	probably benign	0.01
R6637:Muc4	UTSW	16	32753964	missense	probably benign	0.01
R6915:Muc4	UTSW	16	32766938	missense	probably benign	0.18
R6947:Muc4	UTSW	16	32775803	missense	possibly damaging	0.91
R6976:Muc4	UTSW	16	32762518	missense	possibly damaging	0.92
R6985:Muc4	UTSW	16	32751999	missense	probably benign	0.00
R7020:Muc4	UTSW	16	32751810	nonsense	probably null
R7033:Muc4	UTSW	16	32756324	unclassified	probably benign
R7098:Muc4	UTSW	16	32757091	missense
R7123:Muc4	UTSW	16	32750691	missense	possibly damaging	0.83
R7173:Muc4	UTSW	16	32762488	missense	probably damaging	0.97
R7178:Muc4	UTSW	16	32752788	missense	unknown
R7294:Muc4	UTSW	16	32756461	missense	possibly damaging	0.53
R7318:Muc4	UTSW	16	32755336	missense	unknown
R7361:Muc4	UTSW	16	32754670	missense	probably benign	0.18
R7380:Muc4	UTSW	16	32755366	missense	unknown
R7381:Muc4	UTSW	16	32780915	missense
R7411:Muc4	UTSW	16	32751322	missense	probably benign	0.12
R7422:Muc4	UTSW	16	32754689	missense	probably benign	0.00
R7482:Muc4	UTSW	16	32766950	missense
R7539:Muc4	UTSW	16	32756396	missense
R7544:Muc4	UTSW	16	32736198	start codon destroyed	probably null
R7574:Muc4	UTSW	16	32753411	missense	probably benign	0.18
R7576:Muc4	UTSW	16	32754500	missense	probably benign	0.10
R7585:Muc4	UTSW	16	32765702	missense
R7596:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7597:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7602:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7616:Muc4	UTSW	16	32752361	nonsense	probably null
R7639:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7640:Muc4	UTSW	16	32760105	missense
R7651:Muc4	UTSW	16	32756575	missense
R7688:Muc4	UTSW	16	32751460	missense	possibly damaging	0.68
R7689:Muc4	UTSW	16	32753011	missense	probably benign	0.10
R7752:Muc4	UTSW	16	32768734	missense
R7763:Muc4	UTSW	16	32753311	missense	probably benign	0.10
R7768:Muc4	UTSW	16	32756194	missense	unknown
R7787:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7789:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R7838:Muc4	UTSW	16	32752558	nonsense	probably null
R7871:Muc4	UTSW	16	32754935	missense	unknown
R7921:Muc4	UTSW	16	32751321	missense	possibly damaging	0.68
R7927:Muc4	UTSW	16	32771637	missense
R7930:Muc4	UTSW	16	32754078	unclassified	probably benign
R8000:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R8062:Muc4	UTSW	16	32756749	missense
R8096:Muc4	UTSW	16	32755390	missense	unknown
R8115:Muc4	UTSW	16	32755304	missense	unknown
R8162:Muc4	UTSW	16	32750379	missense	unknown
R8220:Muc4	UTSW	16	32755327	missense	unknown
R8260:Muc4	UTSW	16	32754076	unclassified	probably benign
R8290:Muc4	UTSW	16	32754316	missense	probably benign	0.01
R8299:Muc4	UTSW	16	32755897	missense	unknown
R8313:Muc4	UTSW	16	32753423	missense	probably benign	0.04
R8356:Muc4	UTSW	16	32754076	unclassified	probably benign
R8463:Muc4	UTSW	16	32752401	missense	probably benign	0.00
R8479:Muc4	UTSW	16	32753508	missense	possibly damaging	0.59
R8480:Muc4	UTSW	16	32752993	missense	probably benign	0.20
R8510:Muc4	UTSW	16	32754076	unclassified	probably benign
R8515:Muc4	UTSW	16	32755255	missense	unknown
R8559:Muc4	UTSW	16	32754715	missense	unknown
R8685:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R8687:Muc4	UTSW	16	32753930	missense	probably benign	0.01
R8728:Muc4	UTSW	16	32754952	missense	unknown
R8754:Muc4	UTSW	16	32781986	missense
R8845:Muc4	UTSW	16	32756515	missense	possibly damaging	0.86
R8852:Muc4	UTSW	16	32750643	missense	possibly damaging	0.66
R8863:Muc4	UTSW	16	32751462	missense	possibly damaging	0.84
R8896:Muc4	UTSW	16	32754673	missense	probably benign	0.01
R8929:Muc4	UTSW	16	32754017	missense	possibly damaging	0.53
R8929:Muc4	UTSW	16	32753994	missense	probably benign	0.00
R8990:Muc4	UTSW	16	32752209	missense	probably benign	0.01
R9018:Muc4	UTSW	16	32762536	missense
R9034:Muc4	UTSW	16	32754076	unclassified	probably benign
R9064:Muc4	UTSW	16	32754397	missense	possibly damaging	0.53
R9068:Muc4	UTSW	16	32754076	unclassified	probably benign
R9086:Muc4	UTSW	16	32757468	missense
R9151:Muc4	UTSW	16	32752617	missense	probably benign	0.01
R9187:Muc4	UTSW	16	32768728	missense
R9336:Muc4	UTSW	16	32750938	missense	possibly damaging	0.86
R9343:Muc4	UTSW	16	32751153	missense	possibly damaging	0.53
R9363:Muc4	UTSW	16	32756618	missense
R9429:Muc4	UTSW	16	32755724	missense	unknown
R9570:Muc4	UTSW	16	32750877	missense	possibly damaging	0.53
R9609:Muc4	UTSW	16	32756860	missense
R9696:Muc4	UTSW	16	32753284	missense	probably benign	0.00
R9709:Muc4	UTSW	16	32770270	missense
R9743:Muc4	UTSW	16	32780824	missense
R9747:Muc4	UTSW	16	32754698	missense	probably benign	0.01
RF014:Muc4	UTSW	16	32751858	missense	probably damaging	0.98
U15987:Muc4	UTSW	16	32755247	unclassified	probably benign
U15987:Muc4	UTSW	16	32754529	missense	probably benign	0.01
V5622:Muc4	UTSW	16	32751825	missense	probably benign	0.00
X0018:Muc4	UTSW	16	32755481	unclassified	probably benign
X0028:Muc4	UTSW	16	32759319	critical splice donor site	probably null
Z1088:Muc4	UTSW	16	32756076	unclassified	probably benign
Z1176:Muc4	UTSW	16	32768730	missense	possibly damaging	0.65
Z1177:Muc4	UTSW	16	32767393	nonsense	probably null
Z1177:Muc4	UTSW	16	32767394	missense
Z1177:Muc4	UTSW	16	32774862	missense

Predicted Primers

PCR Primer
(F):5'- ACAACAGTTTCTCAGAGCCATC -3'
(R):5'- TCTGTGCAGGAGTTGAGTCAC -3'

Sequencing Primer
(F):5'- GTTTCTCAGAGCCATCATACTACAAG -3'
(R):5'- CAGGAGTTGAGTCACTTGTAGAG -3'

Posted On

2014-07-14