Incidental Mutation 'R1928:Muc4'
ID215106
Institutional Source Beutler Lab
Gene Symbol Muc4
Ensembl Gene ENSMUSG00000079620
Gene Namemucin 4
Synonyms4933405I11Rik
MMRRC Submission 039946-MU
Accession Numbers

Genbank: NM_080457; MGI: 2153525

Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1928 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location32735886-32782391 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32750532 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 137 (S137C)
Ref Sequence ENSEMBL: ENSMUSP00000093813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096106] [ENSMUST00000132475]
Predicted Effect probably damaging
Transcript: ENSMUST00000096106
AA Change: S137C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000093813
Gene: ENSMUSG00000079620
AA Change: S137C

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 37 65 N/A INTRINSIC
low complexity region 86 111 N/A INTRINSIC
internal_repeat_2 119 903 6.07e-127 PROSPERO
internal_repeat_1 164 987 3.47e-144 PROSPERO
internal_repeat_2 979 1875 6.07e-127 PROSPERO
internal_repeat_1 1193 2087 3.47e-144 PROSPERO
low complexity region 2090 2106 N/A INTRINSIC
low complexity region 2111 2119 N/A INTRINSIC
low complexity region 2186 2195 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2324 2332 N/A INTRINSIC
low complexity region 2344 2367 N/A INTRINSIC
NIDO 2458 2615 8.33e-67 SMART
AMOP 2614 2726 1.29e-47 SMART
VWD 2729 2910 4.23e-26 SMART
EGF_like 3134 3166 3.23e1 SMART
EGF_like 3176 3212 3.5e1 SMART
low complexity region 3237 3251 N/A INTRINSIC
EGF 3384 3421 1.4e0 SMART
transmembrane domain 3430 3452 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132475
AA Change: S199C

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119029
Gene: ENSMUSG00000079620
AA Change: S199C

DomainStartEndE-ValueType
low complexity region 38 45 N/A INTRINSIC
low complexity region 72 84 N/A INTRINSIC
low complexity region 99 127 N/A INTRINSIC
low complexity region 148 173 N/A INTRINSIC
low complexity region 192 224 N/A INTRINSIC
low complexity region 283 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142355
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: The major constituents of mucus, the viscous secretion that covers epithelial surfaces such as those in the trachea, colon, and cervix, are highly glycosylated proteins called mucins. These glycoproteins play important roles in the protection of the epithelial cells and have been implicated in epithelial renewal and differentiation. This gene encodes an integral membrane glycoprotein found on the cell surface. A large 5' exon encodes at least 15 tandem repeats of 124-126 amino acids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to DSS-treated colitis and colitis-associated colorectal cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Gramd1b C T 9: 40,306,469 M595I possibly damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Grin2b A G 6: 136,044,046 C86R probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Invs A G 4: 48,390,095 Y251C probably damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Synj2 T A 17: 5,990,267 I121N probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Thbs3 G T 3: 89,217,760 R52L probably damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wdr77 C T 3: 105,967,302 P337S probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zcchc6 A G 13: 59,816,734 L209P probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Muc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00088:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00089:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00090:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00091:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00092:Muc4 APN 16 32754086 missense probably benign 0.35
IGL00163:Muc4 APN 16 32754090 missense probably benign 0.20
IGL00324:Muc4 APN 16 32778812 missense probably benign 0.03
IGL00331:Muc4 APN 16 32753185 missense probably benign 0.01
IGL00539:Muc4 APN 16 32750910 missense possibly damaging 0.53
IGL00590:Muc4 APN 16 32754347 missense probably benign 0.10
IGL00990:Muc4 APN 16 32753955 missense possibly damaging 0.86
IGL00990:Muc4 APN 16 32755805 unclassified probably benign
IGL00990:Muc4 APN 16 32753823 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753848 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753849 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753863 missense probably benign 0.01
IGL00990:Muc4 APN 16 32753886 missense probably benign 0.01
IGL00990:Muc4 APN 16 32752569 missense probably benign 0.01
IGL00990:Muc4 APN 16 32754071 missense probably benign 0.01
IGL01091:Muc4 APN 16 32753927 missense probably benign 0.04
IGL01124:Muc4 APN 16 32768730 missense possibly damaging 0.65
IGL01131:Muc4 APN 16 32753901 missense possibly damaging 0.72
IGL01536:Muc4 APN 16 32763966 missense possibly damaging 0.93
IGL01603:Muc4 APN 16 32750655 missense probably benign 0.23
IGL01618:Muc4 APN 16 32756627 missense unknown
IGL01625:Muc4 APN 16 32755544 unclassified probably benign
IGL01626:Muc4 APN 16 32736402 missense possibly damaging 0.48
IGL01653:Muc4 APN 16 32761348 splice site probably null
IGL01682:Muc4 APN 16 32754086 missense probably benign 0.35
IGL01870:Muc4 APN 16 32753196 missense probably benign 0.01
IGL01966:Muc4 APN 16 32751426 missense possibly damaging 0.84
IGL01973:Muc4 APN 16 32754265 missense probably benign 0.01
IGL02089:Muc4 APN 16 32751313 missense possibly damaging 0.83
IGL02152:Muc4 APN 16 32777649 splice site probably benign
IGL02210:Muc4 APN 16 32752254 missense probably benign 0.00
IGL02278:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02280:Muc4 APN 16 32754529 missense probably benign 0.01
IGL02316:Muc4 APN 16 32750850 missense possibly damaging 0.73
IGL02351:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02358:Muc4 APN 16 32750986 missense possibly damaging 0.86
IGL02391:Muc4 APN 16 32752076 missense probably benign 0.41
IGL02449:Muc4 APN 16 32756129 unclassified probably benign
IGL02607:Muc4 APN 16 32775819 missense possibly damaging 0.73
IGL02888:Muc4 APN 16 32755282 unclassified probably benign
IGL02893:Muc4 APN 16 32751648 missense possibly damaging 0.68
IGL02902:Muc4 APN 16 32750394 missense possibly damaging 0.50
IGL03007:Muc4 APN 16 32752048 missense possibly damaging 0.84
IGL03161:Muc4 APN 16 32751948 missense possibly damaging 0.84
IGL03304:Muc4 APN 16 32751439 nonsense probably null
IGL03335:Muc4 APN 16 32753021 missense probably benign 0.01
IGL03411:Muc4 APN 16 32754318 missense probably benign 0.01
3-1:Muc4 UTSW 16 32760251 splice site probably benign
3-1:Muc4 UTSW 16 32770394 missense possibly damaging 0.86
IGL02835:Muc4 UTSW 16 32763945 missense probably benign 0.32
P0035:Muc4 UTSW 16 32760248 splice site probably benign
PIT4131001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4131001:Muc4 UTSW 16 32755699 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32754529 missense probably benign 0.01
PIT4142001:Muc4 UTSW 16 32755676 unclassified probably benign
PIT4142001:Muc4 UTSW 16 32755684 unclassified probably benign
PIT4366001:Muc4 UTSW 16 32754796 missense unknown
PIT4531001:Muc4 UTSW 16 32756017 missense unknown
R0119:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0133:Muc4 UTSW 16 32771604 missense possibly damaging 0.91
R0136:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0243:Muc4 UTSW 16 32765746 missense possibly damaging 0.53
R0277:Muc4 UTSW 16 32755690 unclassified probably benign
R0299:Muc4 UTSW 16 32750195 critical splice acceptor site probably benign
R0380:Muc4 UTSW 16 32752905 missense probably benign 0.00
R0462:Muc4 UTSW 16 32762536 missense possibly damaging 0.93
R0507:Muc4 UTSW 16 32751069 missense probably benign 0.01
R0508:Muc4 UTSW 16 32751313 missense possibly damaging 0.83
R0543:Muc4 UTSW 16 32756746 missense unknown
R0578:Muc4 UTSW 16 32755690 unclassified probably benign
R0617:Muc4 UTSW 16 32752107 missense possibly damaging 0.83
R0656:Muc4 UTSW 16 32751670 missense possibly damaging 0.91
R0726:Muc4 UTSW 16 32769827 missense probably damaging 0.99
R0727:Muc4 UTSW 16 32769847 missense probably benign 0.01
R0776:Muc4 UTSW 16 32752220 missense probably benign 0.04
R0854:Muc4 UTSW 16 32778955 missense possibly damaging 0.53
R0862:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0864:Muc4 UTSW 16 32752002 missense probably benign 0.01
R0926:Muc4 UTSW 16 32756196 unclassified probably benign
R0990:Muc4 UTSW 16 32752722 missense probably benign 0.00
R1127:Muc4 UTSW 16 32750525 missense possibly damaging 0.92
R1203:Muc4 UTSW 16 32754529 missense probably benign 0.01
R1433:Muc4 UTSW 16 32753020 missense probably benign 0.00
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1466:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1506:Muc4 UTSW 16 32752233 missense possibly damaging 0.59
R1518:Muc4 UTSW 16 32750349 missense possibly damaging 0.84
R1544:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1584:Muc4 UTSW 16 32753595 missense probably benign 0.04
R1593:Muc4 UTSW 16 32754686 missense probably benign 0.00
R1601:Muc4 UTSW 16 32755501 unclassified probably benign
R1611:Muc4 UTSW 16 32750986 missense possibly damaging 0.86
R1673:Muc4 UTSW 16 32756902 missense probably benign 0.11
R1717:Muc4 UTSW 16 32753405 missense possibly damaging 0.53
R1822:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1824:Muc4 UTSW 16 32755933 unclassified probably benign
R1839:Muc4 UTSW 16 32753919 missense probably benign 0.10
R1846:Muc4 UTSW 16 32752369 missense probably benign 0.01
R1864:Muc4 UTSW 16 32756251 unclassified probably benign
R1868:Muc4 UTSW 16 32756341 missense unknown
R1942:Muc4 UTSW 16 32750642 missense probably damaging 0.99
R2017:Muc4 UTSW 16 32751303 missense possibly damaging 0.92
R2023:Muc4 UTSW 16 32752254 missense probably benign 0.00
R2081:Muc4 UTSW 16 32752220 missense probably benign 0.04
R2088:Muc4 UTSW 16 32756409 missense unknown
R2121:Muc4 UTSW 16 32760238 missense unknown
R2139:Muc4 UTSW 16 32761225 missense unknown
R2158:Muc4 UTSW 16 32754563 missense probably benign 0.10
R2165:Muc4 UTSW 16 32750476 missense probably damaging 0.96
R2210:Muc4 UTSW 16 32755176 frame shift probably null
R2225:Muc4 UTSW 16 32755891 unclassified probably benign
R2225:Muc4 UTSW 16 32766942 missense possibly damaging 0.73
R2269:Muc4 UTSW 16 32754529 missense probably benign 0.01
R2679:Muc4 UTSW 16 32757472 missense unknown
R3703:Muc4 UTSW 16 32753919 missense probably benign 0.10
R3816:Muc4 UTSW 16 32754529 missense probably benign 0.01
R3909:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4014:Muc4 UTSW 16 32755273 unclassified probably benign
R4065:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4066:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4067:Muc4 UTSW 16 32751051 missense possibly damaging 0.53
R4245:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4249:Muc4 UTSW 16 32755826 unclassified probably benign
R4344:Muc4 UTSW 16 32770292 missense possibly damaging 0.53
R4388:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4393:Muc4 UTSW 16 32754529 missense probably benign 0.01
R4482:Muc4 UTSW 16 32756701 missense unknown
R4523:Muc4 UTSW 16 32736336 utr 5 prime probably benign
R4527:Muc4 UTSW 16 32755843 unclassified probably benign
R4572:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4587:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4614:Muc4 UTSW 16 32757058 missense probably benign 0.03
R4635:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4661:Muc4 UTSW 16 32769277 missense possibly damaging 0.71
R4701:Muc4 UTSW 16 32755846 unclassified probably benign
R4730:Muc4 UTSW 16 32751214 missense possibly damaging 0.86
R4740:Muc4 UTSW 16 32775903 missense possibly damaging 0.91
R4762:Muc4 UTSW 16 32753625 unclassified probably benign
R4818:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4821:Muc4 UTSW 16 32753802 missense probably benign 0.04
R4825:Muc4 UTSW 16 32751747 missense probably benign 0.41
R4830:Muc4 UTSW 16 32753919 missense probably benign 0.10
R4860:Muc4 UTSW 16 32754616 missense probably benign 0.35
R4860:Muc4 UTSW 16 32754625 missense probably benign 0.18
R4869:Muc4 UTSW 16 32754836 unclassified probably benign
R4934:Muc4 UTSW 16 32756098 unclassified probably benign
R4959:Muc4 UTSW 16 32754319 missense possibly damaging 0.73
R4969:Muc4 UTSW 16 32754572 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754214 missense probably benign 0.01
R4995:Muc4 UTSW 16 32754041 missense probably benign 0.01
R4999:Muc4 UTSW 16 32756296 unclassified probably benign
R5073:Muc4 UTSW 16 32754529 missense probably benign 0.01
R5075:Muc4 UTSW 16 32754794 unclassified probably benign
R5152:Muc4 UTSW 16 32757058 nonsense probably null
R5161:Muc4 UTSW 16 32762521 missense probably damaging 0.98
R5174:Muc4 UTSW 16 32751738 missense possibly damaging 0.84
R5268:Muc4 UTSW 16 32751666 missense possibly damaging 0.83
R5447:Muc4 UTSW 16 32753919 missense probably benign 0.10
R5474:Muc4 UTSW 16 32761261 missense unknown
R5567:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5570:Muc4 UTSW 16 32777692 missense possibly damaging 0.72
R5618:Muc4 UTSW 16 32754253 missense probably benign 0.01
R5665:Muc4 UTSW 16 32750782 missense probably benign 0.33
R5667:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5671:Muc4 UTSW 16 32753720 missense probably benign 0.01
R5693:Muc4 UTSW 16 32776807 missense possibly damaging 0.53
R5703:Muc4 UTSW 16 32736241 nonsense probably null
R5708:Muc4 UTSW 16 32754769 unclassified probably benign
R5715:Muc4 UTSW 16 32751916 missense possibly damaging 0.92
R5849:Muc4 UTSW 16 32774839 missense possibly damaging 0.53
R5873:Muc4 UTSW 16 32751295 missense possibly damaging 0.61
R5930:Muc4 UTSW 16 32751705 missense probably benign 0.41
R5933:Muc4 UTSW 16 32753052 missense probably benign 0.01
R5966:Muc4 UTSW 16 32756278 unclassified probably benign
R6062:Muc4 UTSW 16 32759308 missense unknown
R6067:Muc4 UTSW 16 32755247 unclassified probably benign
R6067:Muc4 UTSW 16 32754529 missense probably benign 0.01
R6078:Muc4 UTSW 16 32755247 unclassified probably benign
R6079:Muc4 UTSW 16 32755247 unclassified probably benign
R6112:Muc4 UTSW 16 32775783 missense possibly damaging 0.86
R6120:Muc4 UTSW 16 32756795 missense unknown
R6144:Muc4 UTSW 16 32766924 missense possibly damaging 0.53
R6148:Muc4 UTSW 16 32753802 missense probably benign 0.04
R6173:Muc4 UTSW 16 32736140 start gained probably benign
R6268:Muc4 UTSW 16 32768767 missense probably damaging 0.99
R6299:Muc4 UTSW 16 32752035 missense possibly damaging 0.48
R6307:Muc4 UTSW 16 32753946 missense possibly damaging 0.56
R6354:Muc4 UTSW 16 32754358 missense probably benign 0.19
R6361:Muc4 UTSW 16 32767351 missense probably benign 0.32
R6375:Muc4 UTSW 16 32736243 utr 5 prime probably benign
R6378:Muc4 UTSW 16 32778946 missense probably benign 0.33
R6418:Muc4 UTSW 16 32751789 missense possibly damaging 0.68
R6458:Muc4 UTSW 16 32759320 critical splice donor site probably null
R6527:Muc4 UTSW 16 32753433 missense probably benign 0.01
R6616:Muc4 UTSW 16 32782008 missense possibly damaging 0.93
R6636:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6637:Muc4 UTSW 16 32753964 missense probably benign 0.01
R6915:Muc4 UTSW 16 32766938 missense probably benign 0.18
R6947:Muc4 UTSW 16 32775803 missense possibly damaging 0.91
R6976:Muc4 UTSW 16 32762518 missense possibly damaging 0.92
R6985:Muc4 UTSW 16 32751999 missense probably benign 0.00
R7020:Muc4 UTSW 16 32751810 nonsense probably null
R7033:Muc4 UTSW 16 32756324 unclassified probably benign
R7098:Muc4 UTSW 16 32757091 missense
R7123:Muc4 UTSW 16 32750691 missense possibly damaging 0.83
R7173:Muc4 UTSW 16 32762488 missense probably damaging 0.97
R7178:Muc4 UTSW 16 32752788 missense unknown
R7294:Muc4 UTSW 16 32756461 missense possibly damaging 0.53
R7318:Muc4 UTSW 16 32755336 missense unknown
R7361:Muc4 UTSW 16 32754670 missense probably benign 0.18
R7380:Muc4 UTSW 16 32755366 missense unknown
R7381:Muc4 UTSW 16 32780915 missense
R7411:Muc4 UTSW 16 32751322 missense probably benign 0.12
R7422:Muc4 UTSW 16 32754689 missense probably benign 0.00
R7482:Muc4 UTSW 16 32766950 missense
R7539:Muc4 UTSW 16 32756396 missense
R7544:Muc4 UTSW 16 32736198 start codon destroyed probably null
U15987:Muc4 UTSW 16 32755247 unclassified probably benign
U15987:Muc4 UTSW 16 32754529 missense probably benign 0.01
V5622:Muc4 UTSW 16 32751825 missense probably benign 0.00
X0018:Muc4 UTSW 16 32755481 unclassified probably benign
X0028:Muc4 UTSW 16 32759319 critical splice donor site probably null
Z1088:Muc4 UTSW 16 32756076 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACAACAGTTTCTCAGAGCCATC -3'
(R):5'- TCTGTGCAGGAGTTGAGTCAC -3'

Sequencing Primer
(F):5'- GTTTCTCAGAGCCATCATACTACAAG -3'
(R):5'- CAGGAGTTGAGTCACTTGTAGAG -3'
Posted On2014-07-14