Incidental Mutation 'R1928:Synj2'
ID215109
Institutional Source Beutler Lab
Gene Symbol Synj2
Ensembl Gene ENSMUSG00000023805
Gene Namesynaptojanin 2
SynonymsSJ2
MMRRC Submission 039946-MU
Accession Numbers

Genbank: NM_001113353.1, NM_001113352.1, NM_011523.2, NM_001113351.1

Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R1928 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location5941280-6044290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5990267 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 121 (I121N)
Ref Sequence ENSEMBL: ENSMUSP00000111456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061091] [ENSMUST00000080283] [ENSMUST00000115788] [ENSMUST00000115789] [ENSMUST00000115790] [ENSMUST00000115791] [ENSMUST00000134767] [ENSMUST00000142409] [ENSMUST00000146009]
Predicted Effect probably damaging
Transcript: ENSMUST00000061091
AA Change: I121N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805
AA Change: I121N

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000080283
AA Change: I206N

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079164
Gene: ENSMUSG00000023805
AA Change: I206N

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 5.5e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1167 1179 N/A INTRINSIC
low complexity region 1217 1234 N/A INTRINSIC
low complexity region 1263 1277 N/A INTRINSIC
low complexity region 1293 1306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115788
SMART Domains Protein: ENSMUSP00000111454
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 4.8e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115789
SMART Domains Protein: ENSMUSP00000111455
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 187 2.3e-60 PFAM
Blast:IPPc 318 347 2e-6 BLAST
IPPc 367 709 3.72e-128 SMART
DUF1866 702 847 1.04e-73 SMART
low complexity region 850 864 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
low complexity region 1056 1073 N/A INTRINSIC
low complexity region 1102 1116 N/A INTRINSIC
low complexity region 1132 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115790
AA Change: I121N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111456
Gene: ENSMUSG00000023805
AA Change: I121N

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 3e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1223 1237 N/A INTRINSIC
low complexity region 1253 1266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115791
AA Change: I206N

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111457
Gene: ENSMUSG00000023805
AA Change: I206N

DomainStartEndE-ValueType
Pfam:Syja_N 61 343 8.5e-67 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1262 1279 N/A INTRINSIC
low complexity region 1308 1322 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134767
Predicted Effect probably benign
Transcript: ENSMUST00000142409
SMART Domains Protein: ENSMUSP00000120006
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 2.5e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146009
AA Change: I206N

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122381
Gene: ENSMUSG00000023805
AA Change: I206N

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 3.6e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
Meta Mutation Damage Score 0.06 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss and cochlear hair cell degeneration associated with fusion of stereocilia followed by total loss of hair bundles and cochlear ganglion degeneration. No vestibular dysfunction or other behavioral deficits are observed. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,626,601 Q64P unknown Het
Adgrv1 A T 13: 81,520,786 F1830L probably benign Het
Anks3 C T 16: 4,946,054 probably null Het
Aqp12 G A 1: 93,006,610 D70N probably damaging Het
B4galnt4 C T 7: 141,068,148 R526* probably null Het
Best2 A G 8: 85,011,253 F171S probably benign Het
C2cd5 A T 6: 143,013,230 V965D probably damaging Het
Cd33 T C 7: 43,529,879 E282G probably benign Het
Cep95 C T 11: 106,790,728 probably benign Het
Chd6 A T 2: 160,968,000 probably benign Het
Clec4d A T 6: 123,267,161 probably null Het
Cntd1 C T 11: 101,283,852 S128L probably damaging Het
Col19a1 T C 1: 24,451,754 probably benign Het
Ctrb1 C A 8: 111,688,692 V117L probably benign Het
Dclk1 T C 3: 55,247,521 V124A possibly damaging Het
Dcp2 T C 18: 44,405,571 probably null Het
Dctn1 C A 6: 83,199,184 probably benign Het
E330009J07Rik A G 6: 40,411,714 F238L probably benign Het
Ephb3 T A 16: 21,222,295 M701K possibly damaging Het
Ero1lb A G 13: 12,601,759 E359G probably damaging Het
Exosc8 G T 3: 54,728,845 A255E probably damaging Het
Fam155a T C 8: 9,770,217 T268A probably benign Het
Fam160a1 G A 3: 85,688,531 P349L probably damaging Het
Fndc3c1 C T X: 106,433,522 A824T probably benign Het
Gja10 G A 4: 32,601,812 Q191* probably null Het
Gm1587 C T 14: 77,798,848 R6Q unknown Het
Gm3409 A G 5: 146,539,608 I190V probably benign Het
Gm4952 G T 19: 12,623,609 M64I probably damaging Het
Gramd1b C T 9: 40,306,469 M595I possibly damaging Het
Grik1 C T 16: 88,051,353 V176M probably damaging Het
Grin2b A G 6: 136,044,046 C86R probably damaging Het
Gtse1 C T 15: 85,862,063 probably benign Het
Hectd2 T C 19: 36,612,319 Y615H probably damaging Het
Hydin T C 8: 110,502,947 F1552S possibly damaging Het
Ifi207 A G 1: 173,729,645 V516A possibly damaging Het
Igfbp5 G T 1: 72,874,025 P39T probably damaging Het
Il23r T A 6: 67,423,735 D537V possibly damaging Het
Invs A G 4: 48,390,095 Y251C probably damaging Het
Isl1 G T 13: 116,308,417 H25Q probably damaging Het
Kif13a A G 13: 46,812,745 L399P probably damaging Het
Klhl1 A G 14: 96,346,789 V335A probably benign Het
Klhl14 C A 18: 21,651,786 A195S probably damaging Het
Lepr A G 4: 101,782,730 probably benign Het
Map1b A C 13: 99,430,946 S1756A unknown Het
Med23 C T 10: 24,909,812 A877V probably benign Het
Mfsd4b2 T C 10: 39,921,462 Y299C probably damaging Het
Mipol1 T A 12: 57,332,419 M221K probably damaging Het
Muc4 A T 16: 32,750,532 S137C probably damaging Het
Mutyh T C 4: 116,816,658 Y189H probably damaging Het
Nabp2 T C 10: 128,409,313 T21A possibly damaging Het
Nell1 T A 7: 50,701,195 V530E possibly damaging Het
Npc1 G C 18: 12,213,378 P254A possibly damaging Het
Nup153 A G 13: 46,701,026 V530A probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr16 T C 1: 172,957,314 V173A probably damaging Het
Olfr747 A G 14: 50,681,415 V73A probably benign Het
Olfr873 T C 9: 20,301,058 V287A probably benign Het
Pabpc1l T A 2: 164,032,254 I193N possibly damaging Het
Pabpc4l A G 3: 46,446,631 Y193H probably damaging Het
Pank1 T C 19: 34,878,881 S66G probably benign Het
Pcdhb1 A T 18: 37,266,180 K395* probably null Het
Pcna A G 2: 132,251,897 probably benign Het
Pgr T A 9: 8,903,629 Y550* probably null Het
Phf11a A G 14: 59,281,867 probably benign Het
Pkhd1 A T 1: 20,081,300 probably benign Het
Pofut2 T A 10: 77,260,808 Y122* probably null Het
Pole A G 5: 110,327,778 M1818V probably benign Het
Rapgef3 A G 15: 97,750,033 L696P probably damaging Het
Rasal3 T C 17: 32,397,353 D310G probably damaging Het
Rhoq A G 17: 86,995,058 K141E probably benign Het
Rilpl1 A G 5: 124,514,750 probably benign Het
Rnaseh1 T C 12: 28,653,089 S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Saa1 C A 7: 46,742,432 G31W probably null Het
Scaf8 A G 17: 3,168,077 T241A unknown Het
Scarb2 C T 5: 92,444,266 A473T possibly damaging Het
Scnn1b T C 7: 121,910,447 F273S probably damaging Het
Sdccag8 T C 1: 176,828,970 V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 V138E probably damaging Het
Sf3a3 G A 4: 124,722,093 A180T possibly damaging Het
Slc16a5 T A 11: 115,470,016 S342T probably damaging Het
Slc18a1 A G 8: 69,073,812 S75P probably benign Het
Slc7a6 T A 8: 106,193,488 probably benign Het
Smco3 G A 6: 136,831,847 Q10* probably null Het
Spem2 T C 11: 69,817,464 Q225R probably benign Het
Ssb G T 2: 69,867,557 probably null Het
Stx8 T C 11: 68,109,280 I182T probably damaging Het
Tbc1d1 T C 5: 64,345,300 Y1055H probably damaging Het
Tex45 T A 8: 3,486,947 I431K possibly damaging Het
Thbs3 G T 3: 89,217,760 R52L probably damaging Het
Tmem101 C T 11: 102,153,396 V222I probably benign Het
Tnks2 C T 19: 36,845,668 Q112* probably null Het
Tnrc6b T A 15: 80,880,723 W809R probably damaging Het
Trib2 T A 12: 15,815,453 R16S probably damaging Het
Trim12a T C 7: 104,307,124 N70D probably damaging Het
Trim55 T A 3: 19,661,882 probably null Het
Tspyl5 T A 15: 33,687,007 D264V probably damaging Het
Ttn A G 2: 76,725,044 V30539A probably damaging Het
Tubgcp3 A G 8: 12,663,988 F43S possibly damaging Het
Ube2cbp A G 9: 86,423,003 L262P probably damaging Het
Ugt1a7c T C 1: 88,095,929 V270A probably benign Het
Vav3 T A 3: 109,506,422 F225L possibly damaging Het
Vmn1r21 G T 6: 57,844,092 Y122* probably null Het
Vmn1r225 C A 17: 20,502,809 Q171K probably benign Het
Vmn2r103 T C 17: 19,811,767 V601A possibly damaging Het
Vmn2r19 T A 6: 123,331,630 N555K probably damaging Het
Vps33a G A 5: 123,558,621 A323V probably benign Het
Wdr77 C T 3: 105,967,302 P337S probably benign Het
Wnk1 A T 6: 119,952,923 I93N probably damaging Het
Zbtb9 T A 17: 26,974,638 I339N probably damaging Het
Zcchc6 A G 13: 59,816,734 L209P probably damaging Het
Zfp202 T A 9: 40,209,787 D241E probably damaging Het
Zfp235 T A 7: 24,141,138 Y327* probably null Het
Zfp820 A C 17: 21,819,335 D337E probably benign Het
Zfp944 T C 17: 22,341,084 T14A probably damaging Het
Zfy1 A G Y: 729,733 V303A unknown Het
Zfyve26 C T 12: 79,239,970 W2281* probably null Het
Other mutations in Synj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Synj2 APN 17 6037926 missense possibly damaging 0.48
IGL01399:Synj2 APN 17 6009771 missense probably damaging 1.00
IGL01793:Synj2 APN 17 6027225 nonsense probably null
IGL01793:Synj2 APN 17 6038046 missense probably benign 0.01
IGL02096:Synj2 APN 17 5990353 missense probably damaging 1.00
IGL02115:Synj2 APN 17 6017590 missense probably damaging 1.00
IGL02222:Synj2 APN 17 6037480 missense probably benign 0.04
IGL02478:Synj2 APN 17 6037924 missense probably benign 0.00
IGL02634:Synj2 APN 17 6029760 missense probably damaging 1.00
IGL02652:Synj2 APN 17 6017593 missense probably damaging 1.00
IGL02681:Synj2 APN 17 5990336 missense probably damaging 1.00
IGL02719:Synj2 APN 17 5996917 missense probably benign 0.02
IGL03253:Synj2 APN 17 6003159 unclassified probably null
IGL03365:Synj2 APN 17 6019404 missense probably damaging 1.00
I2288:Synj2 UTSW 17 6022267 splice site probably benign
I2289:Synj2 UTSW 17 6022267 splice site probably benign
R0389:Synj2 UTSW 17 6029783 missense probably benign 0.35
R0433:Synj2 UTSW 17 6033848 missense probably damaging 1.00
R0530:Synj2 UTSW 17 6008105 missense possibly damaging 0.88
R0539:Synj2 UTSW 17 5996888 start codon destroyed probably null 0.63
R0556:Synj2 UTSW 17 6037955 nonsense probably null
R1263:Synj2 UTSW 17 6019359 missense probably damaging 0.99
R1443:Synj2 UTSW 17 6023665 missense probably damaging 0.99
R1450:Synj2 UTSW 17 6027324 splice site probably benign
R1532:Synj2 UTSW 17 6033919 missense probably benign 0.00
R1542:Synj2 UTSW 17 6025017 missense probably benign 0.01
R1809:Synj2 UTSW 17 6026551 missense possibly damaging 0.95
R1875:Synj2 UTSW 17 6028550 missense possibly damaging 0.69
R1897:Synj2 UTSW 17 6022137 nonsense probably null
R2008:Synj2 UTSW 17 5996946 missense probably damaging 1.00
R2060:Synj2 UTSW 17 6037480 missense probably benign 0.04
R2109:Synj2 UTSW 17 6013691 missense probably benign 0.00
R2332:Synj2 UTSW 17 6023794 missense probably damaging 0.99
R2413:Synj2 UTSW 17 6028574 missense probably damaging 1.00
R3684:Synj2 UTSW 17 6028443 missense probably damaging 0.97
R4111:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4113:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4654:Synj2 UTSW 17 6013538 missense probably damaging 1.00
R4797:Synj2 UTSW 17 6033888 missense probably damaging 1.00
R4812:Synj2 UTSW 17 6010664 missense probably damaging 1.00
R4873:Synj2 UTSW 17 5988068 intron probably benign
R4875:Synj2 UTSW 17 5988068 intron probably benign
R5110:Synj2 UTSW 17 6037715 missense probably benign 0.06
R5205:Synj2 UTSW 17 5941518 missense probably damaging 1.00
R5504:Synj2 UTSW 17 6036475 missense possibly damaging 0.85
R5593:Synj2 UTSW 17 6038115 makesense probably null
R5690:Synj2 UTSW 17 6035527 missense probably benign 0.00
R5870:Synj2 UTSW 17 6037853 missense probably benign 0.00
R6084:Synj2 UTSW 17 6017614 missense probably damaging 0.98
R6084:Synj2 UTSW 17 6038098 missense probably damaging 1.00
R6158:Synj2 UTSW 17 5986212 missense probably benign 0.00
R6159:Synj2 UTSW 17 5986052 missense probably damaging 1.00
R6160:Synj2 UTSW 17 6008061 missense possibly damaging 0.92
R6278:Synj2 UTSW 17 5975874 missense probably damaging 1.00
R6406:Synj2 UTSW 17 6019571 intron probably benign
R6531:Synj2 UTSW 17 6033839 missense probably damaging 1.00
R6729:Synj2 UTSW 17 5986014 start codon destroyed probably null 1.00
R6774:Synj2 UTSW 17 6038015 missense possibly damaging 0.87
R6792:Synj2 UTSW 17 5990290 missense probably benign 0.01
R6844:Synj2 UTSW 17 5975806 missense probably damaging 0.96
R6865:Synj2 UTSW 17 6017569 nonsense probably null
R7178:Synj2 UTSW 17 6026479 missense possibly damaging 0.95
R7286:Synj2 UTSW 17 6037945 missense possibly damaging 0.79
R7403:Synj2 UTSW 17 6037730 missense possibly damaging 0.76
R7451:Synj2 UTSW 17 6029791 missense possibly damaging 0.68
R7501:Synj2 UTSW 17 5990239 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CAGCATTTGTAGAGCCTGGTAG -3'
(R):5'- ATTGGACACGCAGACTTTGTG -3'

Sequencing Primer
(F):5'- TATTGCATGTGCCTCTGC -3'
(R):5'- AGACTTTGTGTGCCCCGGTAC -3'
Posted On2014-07-14