Incidental Mutation 'R1928:Vmn2r103'
ID 215110
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 039946-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R1928 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20032029 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 601 (V601A)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect possibly damaging
Transcript: ENSMUST00000172203
AA Change: V601A

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: V601A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.6%
Validation Efficiency 98% (120/123)
Allele List at MGI
Other mutations in this stock
Total: 117 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik T G 6: 132,603,564 (GRCm39) Q64P unknown Het
Adgrv1 A T 13: 81,668,905 (GRCm39) F1830L probably benign Het
Anks3 C T 16: 4,763,918 (GRCm39) probably null Het
Aqp12 G A 1: 92,934,332 (GRCm39) D70N probably damaging Het
B4galnt4 C T 7: 140,648,061 (GRCm39) R526* probably null Het
Best2 A G 8: 85,737,882 (GRCm39) F171S probably benign Het
C2cd5 A T 6: 142,958,956 (GRCm39) V965D probably damaging Het
Cd33 T C 7: 43,179,303 (GRCm39) E282G probably benign Het
Cep95 C T 11: 106,681,554 (GRCm39) probably benign Het
Chd6 A T 2: 160,809,920 (GRCm39) probably benign Het
Clec4d A T 6: 123,244,120 (GRCm39) probably null Het
Cntd1 C T 11: 101,174,678 (GRCm39) S128L probably damaging Het
Col19a1 T C 1: 24,490,835 (GRCm39) probably benign Het
Ctrb1 C A 8: 112,415,324 (GRCm39) V117L probably benign Het
Dclk1 T C 3: 55,154,942 (GRCm39) V124A possibly damaging Het
Dcp2 T C 18: 44,538,638 (GRCm39) probably null Het
Dctn1 C A 6: 83,176,166 (GRCm39) probably benign Het
Dennd11 A G 6: 40,388,648 (GRCm39) F238L probably benign Het
Ephb3 T A 16: 21,041,045 (GRCm39) M701K possibly damaging Het
Ero1b A G 13: 12,616,648 (GRCm39) E359G probably damaging Het
Exosc8 G T 3: 54,636,266 (GRCm39) A255E probably damaging Het
Fhip1a G A 3: 85,595,838 (GRCm39) P349L probably damaging Het
Fndc3c1 C T X: 105,477,128 (GRCm39) A824T probably benign Het
Gja10 G A 4: 32,601,812 (GRCm39) Q191* probably null Het
Gm1587 C T 14: 78,036,288 (GRCm39) R6Q unknown Het
Gm3409 A G 5: 146,476,418 (GRCm39) I190V probably benign Het
Gm4952 G T 19: 12,600,973 (GRCm39) M64I probably damaging Het
Gramd1b C T 9: 40,217,765 (GRCm39) M595I possibly damaging Het
Grik1 C T 16: 87,848,241 (GRCm39) V176M probably damaging Het
Grin2b A G 6: 136,021,044 (GRCm39) C86R probably damaging Het
Gtse1 C T 15: 85,746,264 (GRCm39) probably benign Het
Hectd2 T C 19: 36,589,719 (GRCm39) Y615H probably damaging Het
Hydin T C 8: 111,229,579 (GRCm39) F1552S possibly damaging Het
Ifi207 A G 1: 173,557,211 (GRCm39) V516A possibly damaging Het
Igfbp5 G T 1: 72,913,184 (GRCm39) P39T probably damaging Het
Il23r T A 6: 67,400,719 (GRCm39) D537V possibly damaging Het
Invs A G 4: 48,390,095 (GRCm39) Y251C probably damaging Het
Isl1 G T 13: 116,444,953 (GRCm39) H25Q probably damaging Het
Kif13a A G 13: 46,966,221 (GRCm39) L399P probably damaging Het
Klhl1 A G 14: 96,584,225 (GRCm39) V335A probably benign Het
Klhl14 C A 18: 21,784,843 (GRCm39) A195S probably damaging Het
Lepr A G 4: 101,639,927 (GRCm39) probably benign Het
Map1b A C 13: 99,567,454 (GRCm39) S1756A unknown Het
Med23 C T 10: 24,785,710 (GRCm39) A877V probably benign Het
Mfsd4b2 T C 10: 39,797,458 (GRCm39) Y299C probably damaging Het
Mipol1 T A 12: 57,379,205 (GRCm39) M221K probably damaging Het
Muc4 A T 16: 32,569,350 (GRCm39) S137C probably damaging Het
Mutyh T C 4: 116,673,855 (GRCm39) Y189H probably damaging Het
Nabp2 T C 10: 128,245,182 (GRCm39) T21A possibly damaging Het
Nalf1 T C 8: 9,820,217 (GRCm39) T268A probably benign Het
Nell1 T A 7: 50,350,943 (GRCm39) V530E possibly damaging Het
Npc1 G C 18: 12,346,435 (GRCm39) P254A possibly damaging Het
Nup153 A G 13: 46,854,502 (GRCm39) V530A probably damaging Het
Nxpe2 T C 9: 48,237,914 (GRCm39) T114A probably damaging Het
Or10j5 T C 1: 172,784,881 (GRCm39) V173A probably damaging Het
Or11h4b A G 14: 50,918,872 (GRCm39) V73A probably benign Het
Or7e177 T C 9: 20,212,354 (GRCm39) V287A probably benign Het
Pabpc1l T A 2: 163,874,174 (GRCm39) I193N possibly damaging Het
Pabpc4l A G 3: 46,401,066 (GRCm39) Y193H probably damaging Het
Pank1 T C 19: 34,856,281 (GRCm39) S66G probably benign Het
Pcdhb1 A T 18: 37,399,233 (GRCm39) K395* probably null Het
Pcna A G 2: 132,093,817 (GRCm39) probably benign Het
Pgr T A 9: 8,903,630 (GRCm39) Y550* probably null Het
Phf11a A G 14: 59,519,316 (GRCm39) probably benign Het
Pkhd1 A T 1: 20,151,524 (GRCm39) probably benign Het
Pofut2 T A 10: 77,096,642 (GRCm39) Y122* probably null Het
Pole A G 5: 110,475,644 (GRCm39) M1818V probably benign Het
Rapgef3 A G 15: 97,647,914 (GRCm39) L696P probably damaging Het
Rasal3 T C 17: 32,616,327 (GRCm39) D310G probably damaging Het
Rhoq A G 17: 87,302,486 (GRCm39) K141E probably benign Het
Rilpl1 A G 5: 124,652,813 (GRCm39) probably benign Het
Rnaseh1 T C 12: 28,703,088 (GRCm39) S91P probably benign Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Saa1 C A 7: 46,391,856 (GRCm39) G31W probably null Het
Saxo5 T A 8: 3,536,947 (GRCm39) I431K possibly damaging Het
Scaf8 A G 17: 3,218,352 (GRCm39) T241A unknown Het
Scarb2 C T 5: 92,592,125 (GRCm39) A473T possibly damaging Het
Scnn1b T C 7: 121,509,670 (GRCm39) F273S probably damaging Het
Sdccag8 T C 1: 176,656,536 (GRCm39) V136A probably damaging Het
Sdr16c6 A T 4: 4,069,926 (GRCm39) V138E probably damaging Het
Sf3a3 G A 4: 124,615,886 (GRCm39) A180T possibly damaging Het
Slc16a5 T A 11: 115,360,842 (GRCm39) S342T probably damaging Het
Slc18a1 A G 8: 69,526,464 (GRCm39) S75P probably benign Het
Slc7a6 T A 8: 106,920,120 (GRCm39) probably benign Het
Smco3 G A 6: 136,808,845 (GRCm39) Q10* probably null Het
Spem2 T C 11: 69,708,290 (GRCm39) Q225R probably benign Het
Ssb G T 2: 69,697,901 (GRCm39) probably null Het
Stx8 T C 11: 68,000,106 (GRCm39) I182T probably damaging Het
Synj2 T A 17: 6,040,542 (GRCm39) I121N probably damaging Het
Tbc1d1 T C 5: 64,502,643 (GRCm39) Y1055H probably damaging Het
Thbs3 G T 3: 89,125,067 (GRCm39) R52L probably damaging Het
Tmem101 C T 11: 102,044,222 (GRCm39) V222I probably benign Het
Tnks2 C T 19: 36,823,068 (GRCm39) Q112* probably null Het
Tnrc6b T A 15: 80,764,924 (GRCm39) W809R probably damaging Het
Trib2 T A 12: 15,865,454 (GRCm39) R16S probably damaging Het
Trim12a T C 7: 103,956,331 (GRCm39) N70D probably damaging Het
Trim55 T A 3: 19,716,046 (GRCm39) probably null Het
Tspyl5 T A 15: 33,687,153 (GRCm39) D264V probably damaging Het
Ttn A G 2: 76,555,388 (GRCm39) V30539A probably damaging Het
Tubgcp3 A G 8: 12,713,988 (GRCm39) F43S possibly damaging Het
Tut7 A G 13: 59,964,548 (GRCm39) L209P probably damaging Het
Ube3d A G 9: 86,305,056 (GRCm39) L262P probably damaging Het
Ugt1a7c T C 1: 88,023,651 (GRCm39) V270A probably benign Het
Vav3 T A 3: 109,413,738 (GRCm39) F225L possibly damaging Het
Vmn1r21 G T 6: 57,821,077 (GRCm39) Y122* probably null Het
Vmn1r225 C A 17: 20,723,071 (GRCm39) Q171K probably benign Het
Vmn2r19 T A 6: 123,308,589 (GRCm39) N555K probably damaging Het
Vps33a G A 5: 123,696,684 (GRCm39) A323V probably benign Het
Wdr77 C T 3: 105,874,618 (GRCm39) P337S probably benign Het
Wnk1 A T 6: 119,929,884 (GRCm39) I93N probably damaging Het
Zbtb9 T A 17: 27,193,612 (GRCm39) I339N probably damaging Het
Zfp202 T A 9: 40,121,083 (GRCm39) D241E probably damaging Het
Zfp235 T A 7: 23,840,563 (GRCm39) Y327* probably null Het
Zfp820 A C 17: 22,038,316 (GRCm39) D337E probably benign Het
Zfp944 T C 17: 22,560,065 (GRCm39) T14A probably damaging Het
Zfy1 A G Y: 729,733 (GRCm39) V303A unknown Het
Zfyve26 C T 12: 79,286,744 (GRCm39) W2281* probably null Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 20,032,077 (GRCm39) missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATTGGACTCCTGTGTTCATGATAAC -3'
(R):5'- TGGCCAACACAGTAGCAAG -3'

Sequencing Primer
(F):5'- CAGAGAGGAACAACTGCT -3'
(R):5'- CACAGTAGCAAGAGCCATAGTG -3'
Posted On 2014-07-14