Incidental Mutation 'R0128:Ccdc138'
ID 21515
Institutional Source Beutler Lab
Gene Symbol Ccdc138
Ensembl Gene ENSMUSG00000038010
Gene Name coiled-coil domain containing 138
Synonyms 6230424H07Rik
MMRRC Submission 038413-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R0128 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 10
Chromosomal Location 58333770-58412066 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58364182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 314 (I314N)
Ref Sequence ENSEMBL: ENSMUSP00000043040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036576]
AlphaFold Q0VF22
Predicted Effect probably damaging
Transcript: ENSMUST00000036576
AA Change: I314N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043040
Gene: ENSMUSG00000038010
AA Change: I314N

DomainStartEndE-ValueType
coiled coil region 259 339 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Meta Mutation Damage Score 0.2517 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,602 (GRCm39) probably benign Het
Abcd4 T G 12: 84,659,126 (GRCm39) Q210P possibly damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Acte1 G T 7: 143,445,492 (GRCm39) G178C probably damaging Het
Actl6b A G 5: 137,553,327 (GRCm39) N113S probably benign Het
Actn3 A T 19: 4,921,643 (GRCm39) V179E probably damaging Het
Aff4 C A 11: 53,306,293 (GRCm39) T1145N probably damaging Het
Ankrd42 G A 7: 92,241,067 (GRCm39) Q431* probably null Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Asap3 C A 4: 135,961,915 (GRCm39) N285K probably damaging Het
Atp6v0a2 A G 5: 124,790,248 (GRCm39) N477S probably damaging Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
C87436 G A 6: 86,446,809 (GRCm39) G533D probably damaging Het
Ccs A G 19: 4,875,654 (GRCm39) F237S probably damaging Het
Ccz1 T G 5: 143,946,112 (GRCm39) probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Chd1 A G 17: 17,613,829 (GRCm39) N531S probably damaging Het
Clptm1 A T 7: 19,368,932 (GRCm39) F476I probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dlg1 G T 16: 31,676,883 (GRCm39) probably null Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Ergic3 C A 2: 155,853,060 (GRCm39) R43S possibly damaging Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Ghrl A T 6: 113,694,129 (GRCm39) probably benign Het
Gm4787 T A 12: 81,424,521 (GRCm39) K546* probably null Het
Gm6576 C G 15: 27,026,086 (GRCm39) noncoding transcript Het
Got1 C T 19: 43,512,816 (GRCm39) D27N probably benign Het
Gucy2c C T 6: 136,681,247 (GRCm39) V946I probably damaging Het
Hectd4 T C 5: 121,487,306 (GRCm39) Y3434H possibly damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Itpr1 A G 6: 108,448,170 (GRCm39) probably benign Het
Kctd1 G A 18: 15,107,237 (GRCm39) P743S probably benign Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Krt24 T C 11: 99,171,093 (GRCm39) D495G probably damaging Het
L3hypdh C T 12: 72,123,917 (GRCm39) probably null Het
Lipo3 C T 19: 33,534,506 (GRCm39) probably null Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k4 T A 17: 12,466,950 (GRCm39) D1104V probably damaging Het
Mpeg1 T C 19: 12,438,587 (GRCm39) V15A probably benign Het
Narf C T 11: 121,141,662 (GRCm39) R356C probably damaging Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Olfm5 G A 7: 103,810,133 (GRCm39) A76V probably benign Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or52p1 A T 7: 104,267,788 (GRCm39) I301F probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Palb2 A T 7: 121,727,389 (GRCm39) Y160* probably null Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pdcd11 G A 19: 47,108,301 (GRCm39) V1223I probably benign Het
Pde6c T C 19: 38,157,813 (GRCm39) probably benign Het
Prr12 A G 7: 44,699,463 (GRCm39) probably benign Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sfr1 A G 19: 47,723,457 (GRCm39) *320W probably null Het
Sft2d1rt A G 11: 45,943,120 (GRCm39) M1T probably null Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Slc1a3 T C 15: 8,665,693 (GRCm39) M519V probably benign Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Spag9 T A 11: 93,984,365 (GRCm39) I327N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Unc79 A G 12: 103,054,693 (GRCm39) probably benign Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Wrap73 A G 4: 154,226,957 (GRCm39) D19G possibly damaging Het
Other mutations in Ccdc138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc138 APN 10 58,411,537 (GRCm39) missense probably damaging 1.00
IGL00957:Ccdc138 APN 10 58,364,838 (GRCm39) splice site probably benign
IGL01012:Ccdc138 APN 10 58,376,737 (GRCm39) critical splice donor site probably null
IGL01725:Ccdc138 APN 10 58,364,745 (GRCm39) missense possibly damaging 0.50
IGL01996:Ccdc138 APN 10 58,397,852 (GRCm39) missense probably damaging 1.00
IGL02083:Ccdc138 APN 10 58,380,736 (GRCm39) splice site probably benign
IGL02652:Ccdc138 APN 10 58,348,901 (GRCm39) missense probably benign 0.00
IGL02820:Ccdc138 APN 10 58,364,721 (GRCm39) splice site probably benign
IGL02934:Ccdc138 APN 10 58,409,402 (GRCm39) splice site probably benign
IGL03231:Ccdc138 APN 10 58,409,528 (GRCm39) missense probably damaging 1.00
R0271:Ccdc138 UTSW 10 58,411,645 (GRCm39) missense probably damaging 0.99
R0480:Ccdc138 UTSW 10 58,397,789 (GRCm39) missense probably damaging 1.00
R0560:Ccdc138 UTSW 10 58,411,539 (GRCm39) missense probably damaging 1.00
R0645:Ccdc138 UTSW 10 58,411,542 (GRCm39) missense probably damaging 1.00
R1405:Ccdc138 UTSW 10 58,380,939 (GRCm39) splice site probably benign
R2032:Ccdc138 UTSW 10 58,348,984 (GRCm39) missense possibly damaging 0.71
R2097:Ccdc138 UTSW 10 58,397,759 (GRCm39) nonsense probably null
R2350:Ccdc138 UTSW 10 58,397,715 (GRCm39) splice site probably benign
R2571:Ccdc138 UTSW 10 58,349,044 (GRCm39) missense probably benign 0.25
R3787:Ccdc138 UTSW 10 58,374,092 (GRCm39) missense probably damaging 1.00
R3805:Ccdc138 UTSW 10 58,397,819 (GRCm39) missense possibly damaging 0.95
R4582:Ccdc138 UTSW 10 58,343,465 (GRCm39) critical splice donor site probably null
R4630:Ccdc138 UTSW 10 58,409,477 (GRCm39) missense probably damaging 1.00
R4801:Ccdc138 UTSW 10 58,409,465 (GRCm39) missense probably damaging 1.00
R4802:Ccdc138 UTSW 10 58,409,465 (GRCm39) missense probably damaging 1.00
R4883:Ccdc138 UTSW 10 58,397,818 (GRCm39) missense probably benign 0.03
R4908:Ccdc138 UTSW 10 58,380,817 (GRCm39) missense possibly damaging 0.84
R5032:Ccdc138 UTSW 10 58,409,458 (GRCm39) missense probably damaging 1.00
R5155:Ccdc138 UTSW 10 58,343,394 (GRCm39) missense probably benign 0.00
R5287:Ccdc138 UTSW 10 58,411,527 (GRCm39) missense possibly damaging 0.89
R5683:Ccdc138 UTSW 10 58,376,641 (GRCm39) missense probably damaging 1.00
R5963:Ccdc138 UTSW 10 58,411,579 (GRCm39) missense possibly damaging 0.90
R6530:Ccdc138 UTSW 10 58,380,790 (GRCm39) missense probably damaging 1.00
R7148:Ccdc138 UTSW 10 58,374,102 (GRCm39) missense probably damaging 1.00
R7217:Ccdc138 UTSW 10 58,345,422 (GRCm39) missense probably benign 0.33
R9031:Ccdc138 UTSW 10 58,380,893 (GRCm39) missense probably damaging 1.00
R9080:Ccdc138 UTSW 10 58,397,884 (GRCm39) missense probably damaging 0.99
R9104:Ccdc138 UTSW 10 58,348,982 (GRCm39) missense probably benign 0.05
R9134:Ccdc138 UTSW 10 58,374,102 (GRCm39) missense probably damaging 0.99
R9300:Ccdc138 UTSW 10 58,343,448 (GRCm39) missense probably benign 0.00
R9409:Ccdc138 UTSW 10 58,374,135 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTTGGAATGGTTACAGACTCTTTC -3'
(R):5'- ATTAAGGAGCAATCTTACAAAACGCAGC -3'

Sequencing Primer
(F):5'- TGTTGATAGTCAACCATCATAGGAG -3'
(R):5'- ccaacatcctctctgacttcc -3'
Posted On 2013-04-11