Incidental Mutation 'R0128:Aff4'
ID 21517
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene Name AF4/FMR2 family, member 4
Synonyms Laf4l, Alf4
MMRRC Submission 038413-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0128 (G1)
Quality Score 189
Status Validated (trace)
Chromosome 11
Chromosomal Location 53241660-53312657 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 53306293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 1145 (T1145N)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
AlphaFold Q9ESC8
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: T1145N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: T1145N

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129019
Meta Mutation Damage Score 0.2525 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,602 (GRCm39) probably benign Het
Abcd4 T G 12: 84,659,126 (GRCm39) Q210P possibly damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Acte1 G T 7: 143,445,492 (GRCm39) G178C probably damaging Het
Actl6b A G 5: 137,553,327 (GRCm39) N113S probably benign Het
Actn3 A T 19: 4,921,643 (GRCm39) V179E probably damaging Het
Ankrd42 G A 7: 92,241,067 (GRCm39) Q431* probably null Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Asap3 C A 4: 135,961,915 (GRCm39) N285K probably damaging Het
Atp6v0a2 A G 5: 124,790,248 (GRCm39) N477S probably damaging Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
C87436 G A 6: 86,446,809 (GRCm39) G533D probably damaging Het
Ccdc138 T A 10: 58,364,182 (GRCm39) I314N probably damaging Het
Ccs A G 19: 4,875,654 (GRCm39) F237S probably damaging Het
Ccz1 T G 5: 143,946,112 (GRCm39) probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Chd1 A G 17: 17,613,829 (GRCm39) N531S probably damaging Het
Clptm1 A T 7: 19,368,932 (GRCm39) F476I probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dlg1 G T 16: 31,676,883 (GRCm39) probably null Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Ergic3 C A 2: 155,853,060 (GRCm39) R43S possibly damaging Het
Flnb T C 14: 7,901,951 (GRCm38) V938A probably damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Ghrl A T 6: 113,694,129 (GRCm39) probably benign Het
Gm4787 T A 12: 81,424,521 (GRCm39) K546* probably null Het
Gm6576 C G 15: 27,026,086 (GRCm39) noncoding transcript Het
Got1 C T 19: 43,512,816 (GRCm39) D27N probably benign Het
Gucy2c C T 6: 136,681,247 (GRCm39) V946I probably damaging Het
Hectd4 T C 5: 121,487,306 (GRCm39) Y3434H possibly damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Itpr1 A G 6: 108,448,170 (GRCm39) probably benign Het
Kctd1 G A 18: 15,107,237 (GRCm39) P743S probably benign Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Krt24 T C 11: 99,171,093 (GRCm39) D495G probably damaging Het
L3hypdh C T 12: 72,123,917 (GRCm39) probably null Het
Lipo3 C T 19: 33,534,506 (GRCm39) probably null Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k4 T A 17: 12,466,950 (GRCm39) D1104V probably damaging Het
Mpeg1 T C 19: 12,438,587 (GRCm39) V15A probably benign Het
Narf C T 11: 121,141,662 (GRCm39) R356C probably damaging Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Olfm5 G A 7: 103,810,133 (GRCm39) A76V probably benign Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or52p1 A T 7: 104,267,788 (GRCm39) I301F probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Palb2 A T 7: 121,727,389 (GRCm39) Y160* probably null Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pdcd11 G A 19: 47,108,301 (GRCm39) V1223I probably benign Het
Pde6c T C 19: 38,157,813 (GRCm39) probably benign Het
Prr12 A G 7: 44,699,463 (GRCm39) probably benign Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sfr1 A G 19: 47,723,457 (GRCm39) *320W probably null Het
Sft2d1rt A G 11: 45,943,120 (GRCm39) M1T probably null Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Slc1a3 T C 15: 8,665,693 (GRCm39) M519V probably benign Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Spag9 T A 11: 93,984,365 (GRCm39) I327N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Unc79 A G 12: 103,054,693 (GRCm39) probably benign Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Wrap73 A G 4: 154,226,957 (GRCm39) D19G possibly damaging Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53,302,817 (GRCm39) missense probably damaging 0.98
IGL01348:Aff4 APN 11 53,293,327 (GRCm39) missense probably benign
IGL01446:Aff4 APN 11 53,306,296 (GRCm39) missense probably damaging 0.99
IGL02151:Aff4 APN 11 53,290,633 (GRCm39) missense probably benign
IGL02526:Aff4 APN 11 53,297,509 (GRCm39) splice site probably benign
IGL02567:Aff4 APN 11 53,263,578 (GRCm39) missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53,300,198 (GRCm39) splice site probably benign
IGL02707:Aff4 APN 11 53,290,567 (GRCm39) missense probably benign
R0090:Aff4 UTSW 11 53,283,609 (GRCm39) missense probably benign 0.01
R0243:Aff4 UTSW 11 53,288,685 (GRCm39) missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53,263,708 (GRCm39) missense probably benign 0.00
R0347:Aff4 UTSW 11 53,290,915 (GRCm39) missense probably benign 0.01
R0732:Aff4 UTSW 11 53,266,423 (GRCm39) missense probably benign
R0737:Aff4 UTSW 11 53,301,780 (GRCm39) nonsense probably null
R1464:Aff4 UTSW 11 53,263,351 (GRCm39) missense probably damaging 0.97
R1464:Aff4 UTSW 11 53,263,351 (GRCm39) missense probably damaging 0.97
R1500:Aff4 UTSW 11 53,263,205 (GRCm39) missense probably benign 0.00
R1693:Aff4 UTSW 11 53,287,380 (GRCm39) missense probably damaging 1.00
R1743:Aff4 UTSW 11 53,259,522 (GRCm39) missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53,263,826 (GRCm39) missense probably damaging 1.00
R2048:Aff4 UTSW 11 53,289,212 (GRCm39) missense probably benign 0.39
R2138:Aff4 UTSW 11 53,263,339 (GRCm39) missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53,290,446 (GRCm39) missense probably damaging 1.00
R2379:Aff4 UTSW 11 53,299,305 (GRCm39) splice site probably benign
R4156:Aff4 UTSW 11 53,301,726 (GRCm39) intron probably benign
R5001:Aff4 UTSW 11 53,295,184 (GRCm39) missense probably damaging 1.00
R5281:Aff4 UTSW 11 53,263,115 (GRCm39) missense probably damaging 1.00
R5477:Aff4 UTSW 11 53,299,299 (GRCm39) critical splice donor site probably null
R5677:Aff4 UTSW 11 53,291,102 (GRCm39) missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53,263,837 (GRCm39) missense probably damaging 0.99
R6576:Aff4 UTSW 11 53,291,268 (GRCm39) missense probably damaging 1.00
R6764:Aff4 UTSW 11 53,290,657 (GRCm39) missense probably damaging 1.00
R6988:Aff4 UTSW 11 53,289,064 (GRCm39) missense probably damaging 1.00
R7034:Aff4 UTSW 11 53,299,236 (GRCm39) missense probably damaging 0.99
R7177:Aff4 UTSW 11 53,297,466 (GRCm39) missense probably benign 0.10
R7426:Aff4 UTSW 11 53,263,702 (GRCm39) missense probably damaging 1.00
R7755:Aff4 UTSW 11 53,289,206 (GRCm39) missense probably damaging 0.97
R7848:Aff4 UTSW 11 53,295,339 (GRCm39) missense probably benign 0.05
R7968:Aff4 UTSW 11 53,300,175 (GRCm39) missense probably damaging 1.00
R8159:Aff4 UTSW 11 53,302,721 (GRCm39) missense possibly damaging 0.71
R8218:Aff4 UTSW 11 53,289,084 (GRCm39) missense probably damaging 0.98
R8241:Aff4 UTSW 11 53,290,998 (GRCm39) missense probably benign 0.00
R8284:Aff4 UTSW 11 53,295,379 (GRCm39) missense probably damaging 0.99
R8373:Aff4 UTSW 11 53,291,094 (GRCm39) nonsense probably null
R8695:Aff4 UTSW 11 53,259,509 (GRCm39) missense probably damaging 1.00
R8777:Aff4 UTSW 11 53,290,783 (GRCm39) missense probably damaging 1.00
R8777-TAIL:Aff4 UTSW 11 53,290,783 (GRCm39) missense probably damaging 1.00
R8780:Aff4 UTSW 11 53,271,444 (GRCm39) missense probably damaging 1.00
R8798:Aff4 UTSW 11 53,291,335 (GRCm39) critical splice donor site probably benign
R8838:Aff4 UTSW 11 53,297,465 (GRCm39) missense possibly damaging 0.77
R8939:Aff4 UTSW 11 53,263,231 (GRCm39) missense probably benign
R9146:Aff4 UTSW 11 53,298,963 (GRCm39) missense probably benign 0.06
R9329:Aff4 UTSW 11 53,288,686 (GRCm39) missense probably damaging 1.00
R9378:Aff4 UTSW 11 53,263,306 (GRCm39) missense probably damaging 0.98
R9471:Aff4 UTSW 11 53,271,473 (GRCm39) missense probably benign 0.13
R9779:Aff4 UTSW 11 53,263,734 (GRCm39) nonsense probably null
R9796:Aff4 UTSW 11 53,302,824 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTCCTGAACCTGAGACTTTGTAGCG -3'
(R):5'- GCTTTAAACAAGCTCCAATCTGGGAAC -3'

Sequencing Primer
(F):5'- AGACTTTGTAGCGGCCTTTAG -3'
(R):5'- GTCACATTGGGACTCTTCAAAGG -3'
Posted On 2013-04-11