Incidental Mutation 'R1929:Cyfip1'
ID215172
Institutional Source Beutler Lab
Gene Symbol Cyfip1
Ensembl Gene ENSMUSG00000030447
Gene Namecytoplasmic FMR1 interacting protein 1
Synonymsl(7)1Rl, pl-1, P140SRA-1, l7Rl1, Sra-1, Shyc, E030028J09Rik
MMRRC Submission 039947-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1929 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55841745-55932602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55899957 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 624 (R624L)
Ref Sequence ENSEMBL: ENSMUSP00000127717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032629] [ENSMUST00000085255] [ENSMUST00000163845] [ENSMUST00000206862]
Predicted Effect probably null
Transcript: ENSMUST00000032629
AA Change: R624L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032629
Gene: ENSMUSG00000030447
AA Change: R624L

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 302 5.7e-11 PFAM
Pfam:FragX_IP 389 1222 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085255
AA Change: R622L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082353
Gene: ENSMUSG00000030447
AA Change: R622L

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1222 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163845
AA Change: R624L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127717
Gene: ENSMUSG00000030447
AA Change: R624L

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 385 1224 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174660
Predicted Effect probably null
Transcript: ENSMUST00000206862
AA Change: R594L

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.9752 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 98% (107/109)
MGI Phenotype PHENOTYPE: Mutations at this locus result in embryonic lethality before the turning stage in homozygotes. Heterozygotes exhibit abnormal synaptic transmission. Parental origin of the mutant allele in heterozygotes has an effect on long term depression, cued fear conditioning, anxiety, and activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Amdhd2 T C 17: 24,157,886 probably null Het
Angel1 A C 12: 86,702,319 L656V probably damaging Het
Ankrd12 G A 17: 65,986,686 S584L possibly damaging Het
Apbb2 T A 5: 66,307,615 N679Y probably benign Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Bnip3 T G 7: 138,894,630 silent Het
Btc T C 5: 91,362,401 Y111C probably damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cd2bp2 T C 7: 127,193,878 D324G probably benign Het
Cdc20b A G 13: 113,071,917 T216A probably benign Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Cenpv T C 11: 62,525,233 E230G probably benign Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyp27b1 T A 10: 127,048,312 V11D probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 65,976,398 S2785G probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Dtx3l A T 16: 35,933,689 D182E possibly damaging Het
Efcab6 A G 15: 83,892,962 probably benign Het
Elac2 T A 11: 64,979,189 S27T probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgd6 T C 10: 94,045,006 V574A probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Focad A G 4: 88,342,212 N902D unknown Het
Focad A G 4: 88,397,179 S1525G probably benign Het
Fras1 T C 5: 96,667,437 W1338R probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Gm10076 T G 14: 105,681,870 noncoding transcript Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Gm5698 T G 1: 30,977,961 D3A probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gngt2 C T 11: 95,845,146 probably benign Het
Gsdma T C 11: 98,671,367 probably null Het
Gtf2h3 A T 5: 124,602,199 probably benign Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk16 A G 14: 20,265,279 V72A probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matr3 T A 18: 35,588,325 probably benign Het
Med13l T G 5: 118,728,833 F651V probably benign Het
Mfsd11 T C 11: 116,873,914 V388A probably benign Het
Mki67 C T 7: 135,698,065 V1747I possibly damaging Het
Mms22l T C 4: 24,535,936 probably benign Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1234 A G 2: 89,363,009 V140A probably benign Het
Olfr376 T A 11: 73,375,601 V287E probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
P4ha1 A G 10: 59,371,037 E523G probably damaging Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Pigr G A 1: 130,846,662 probably benign Het
Pkd1l1 A T 11: 8,836,197 probably benign Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Rgs3 A G 4: 62,702,147 I537V probably damaging Het
Rhobtb2 T G 14: 69,796,444 D444A probably damaging Het
Rnf40 T C 7: 127,591,784 S314P probably damaging Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Samd3 A G 10: 26,263,986 probably benign Het
Sec61a2 A G 2: 5,873,736 probably benign Het
Serpina3m G A 12: 104,389,322 A83T probably damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Sez6 C T 11: 77,972,932 T439I probably damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Spg11 C T 2: 122,060,207 V2044M probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Suclg2 T C 6: 95,589,094 probably benign Het
Tlr4 A T 4: 66,839,444 H158L probably damaging Het
Tmem131 A G 1: 36,812,271 V966A possibly damaging Het
Tram1l1 T A 3: 124,321,986 I265N probably damaging Het
Trim58 T A 11: 58,640,667 F67Y possibly damaging Het
Ttc19 A G 11: 62,281,824 Q74R probably benign Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn2r16 A G 5: 109,339,258 Y115C possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp451 A G 1: 33,782,193 F151L probably damaging Het
Zfp451 G A 1: 33,783,856 P99S probably benign Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp804b A G 5: 6,769,748 V1069A probably benign Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Cyfip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Cyfip1 APN 7 55904210 missense probably damaging 1.00
IGL01351:Cyfip1 APN 7 55898243 nonsense probably null
IGL01662:Cyfip1 APN 7 55896739 missense probably damaging 1.00
IGL02034:Cyfip1 APN 7 55898353 missense probably damaging 0.99
IGL02039:Cyfip1 APN 7 55875021 missense possibly damaging 0.90
IGL02063:Cyfip1 APN 7 55926348 missense probably damaging 1.00
IGL02429:Cyfip1 APN 7 55871982 splice site probably benign
IGL03256:Cyfip1 APN 7 55907434 missense possibly damaging 0.67
R0455:Cyfip1 UTSW 7 55892054 missense probably benign 0.18
R0546:Cyfip1 UTSW 7 55922816 nonsense probably null
R0671:Cyfip1 UTSW 7 55923962 unclassified probably null
R0732:Cyfip1 UTSW 7 55886781 missense probably damaging 1.00
R0843:Cyfip1 UTSW 7 55922820 missense probably benign 0.24
R1666:Cyfip1 UTSW 7 55871898 missense probably damaging 0.99
R1789:Cyfip1 UTSW 7 55926395 missense probably damaging 1.00
R1817:Cyfip1 UTSW 7 55873448 missense possibly damaging 0.51
R2271:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2272:Cyfip1 UTSW 7 55899957 missense probably null 1.00
R2328:Cyfip1 UTSW 7 55894991 missense possibly damaging 0.87
R2518:Cyfip1 UTSW 7 55928284 missense probably damaging 1.00
R2963:Cyfip1 UTSW 7 55895035 missense probably damaging 0.99
R4271:Cyfip1 UTSW 7 55879101 missense probably benign 0.02
R4435:Cyfip1 UTSW 7 55900041 missense probably damaging 0.99
R4640:Cyfip1 UTSW 7 55913451 missense possibly damaging 0.92
R4676:Cyfip1 UTSW 7 55875013 missense probably damaging 0.99
R4887:Cyfip1 UTSW 7 55872068 missense probably damaging 1.00
R5085:Cyfip1 UTSW 7 55898335 missense probably benign 0.33
R5238:Cyfip1 UTSW 7 55892031 missense probably benign
R5244:Cyfip1 UTSW 7 55925199 missense probably damaging 1.00
R5288:Cyfip1 UTSW 7 55925135 missense possibly damaging 0.60
R5294:Cyfip1 UTSW 7 55873483 missense possibly damaging 0.88
R5552:Cyfip1 UTSW 7 55872107 missense possibly damaging 0.94
R5558:Cyfip1 UTSW 7 55892001 missense possibly damaging 0.71
R5667:Cyfip1 UTSW 7 55873730 missense probably benign 0.19
R5819:Cyfip1 UTSW 7 55879151 missense probably damaging 1.00
R5859:Cyfip1 UTSW 7 55925181 missense probably damaging 1.00
R5867:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5868:Cyfip1 UTSW 7 55926313 missense probably damaging 1.00
R5944:Cyfip1 UTSW 7 55872130 missense probably damaging 0.98
R6124:Cyfip1 UTSW 7 55897943 missense probably benign 0.12
R6131:Cyfip1 UTSW 7 55873480 missense possibly damaging 0.79
R6219:Cyfip1 UTSW 7 55908441 missense possibly damaging 0.52
R6243:Cyfip1 UTSW 7 55900529 missense probably damaging 1.00
R6669:Cyfip1 UTSW 7 55900061 missense probably damaging 0.99
R6869:Cyfip1 UTSW 7 55907365 missense possibly damaging 0.73
R7014:Cyfip1 UTSW 7 55919493 missense probably benign 0.34
R7224:Cyfip1 UTSW 7 55928189 frame shift probably null
R7225:Cyfip1 UTSW 7 55928189 frame shift probably null
R7305:Cyfip1 UTSW 7 55928189 frame shift probably null
R7336:Cyfip1 UTSW 7 55926400 missense possibly damaging 0.96
R7429:Cyfip1 UTSW 7 55900593 missense probably damaging 1.00
R7430:Cyfip1 UTSW 7 55900593 missense probably damaging 1.00
R7469:Cyfip1 UTSW 7 55877720 missense possibly damaging 0.91
R7568:Cyfip1 UTSW 7 55872249 intron probably null
R7830:Cyfip1 UTSW 7 55873462 missense probably damaging 1.00
R7839:Cyfip1 UTSW 7 55886735 missense probably damaging 0.98
R7859:Cyfip1 UTSW 7 55900026 missense probably damaging 1.00
R7922:Cyfip1 UTSW 7 55886735 missense probably damaging 0.98
R7942:Cyfip1 UTSW 7 55900026 missense probably damaging 1.00
X0018:Cyfip1 UTSW 7 55900025 missense probably damaging 0.98
X0028:Cyfip1 UTSW 7 55907430 missense probably damaging 1.00
Z1088:Cyfip1 UTSW 7 55875052 missense probably damaging 0.99
Z1177:Cyfip1 UTSW 7 55898320 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCATACCCGTGTTCGTCTTG -3'
(R):5'- CTGAATGAATGTGTGAAGGTACATG -3'

Sequencing Primer
(F):5'- CTCATGTGAAGTGTCCAGTGACC -3'
(R):5'- AATGTGTGAAGGTACATGCATGTG -3'
Posted On2014-07-14