Incidental Mutation 'R1929:Specc1l'
ID215190
Institutional Source Beutler Lab
Gene Symbol Specc1l
Ensembl Gene ENSMUSG00000033444
Gene Namesperm antigen with calponin homology and coiled-coil domains 1-like
SynonymsCytsa, Specc1l
MMRRC Submission 039947-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.605) question?
Stock #R1929 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75212073-75312743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75245604 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 278 (S278F)
Ref Sequence ENSEMBL: ENSMUSP00000151322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040105] [ENSMUST00000105421] [ENSMUST00000218766] [ENSMUST00000219387]
Predicted Effect probably damaging
Transcript: ENSMUST00000040105
AA Change: S295F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045099
Gene: ENSMUSG00000033444
AA Change: S295F

DomainStartEndE-ValueType
low complexity region 97 107 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
coiled coil region 255 298 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
coiled coil region 412 467 N/A INTRINSIC
coiled coil region 505 825 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 989 1010 N/A INTRINSIC
CH 1031 1129 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105421
AA Change: S295F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101061
Gene: ENSMUSG00000033444
AA Change: S295F

DomainStartEndE-ValueType
low complexity region 80 90 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
coiled coil region 238 281 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
coiled coil region 395 450 N/A INTRINSIC
coiled coil region 488 808 N/A INTRINSIC
low complexity region 829 841 N/A INTRINSIC
low complexity region 972 993 N/A INTRINSIC
CH 1014 1112 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218766
AA Change: S278F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218876
Predicted Effect probably benign
Transcript: ENSMUST00000219387
Meta Mutation Damage Score 0.4350 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous knockout affects cranial neural crest cell migration, which causes neural tube closure defects and leads to embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Amdhd2 T C 17: 24,157,886 probably null Het
Angel1 A C 12: 86,702,319 L656V probably damaging Het
Ankrd12 G A 17: 65,986,686 S584L possibly damaging Het
Apbb2 T A 5: 66,307,615 N679Y probably benign Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Bnip3 T G 7: 138,894,630 silent Het
Btc T C 5: 91,362,401 Y111C probably damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cd2bp2 T C 7: 127,193,878 D324G probably benign Het
Cdc20b A G 13: 113,071,917 T216A probably benign Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Cenpv T C 11: 62,525,233 E230G probably benign Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27b1 T A 10: 127,048,312 V11D probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 65,976,398 S2785G probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Dtx3l A T 16: 35,933,689 D182E possibly damaging Het
Efcab6 A G 15: 83,892,962 probably benign Het
Elac2 T A 11: 64,979,189 S27T probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgd6 T C 10: 94,045,006 V574A probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Focad A G 4: 88,342,212 N902D unknown Het
Focad A G 4: 88,397,179 S1525G probably benign Het
Fras1 T C 5: 96,667,437 W1338R probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Gm10076 T G 14: 105,681,870 noncoding transcript Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Gm5698 T G 1: 30,977,961 D3A probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gngt2 C T 11: 95,845,146 probably benign Het
Gsdma T C 11: 98,671,367 probably null Het
Gtf2h3 A T 5: 124,602,199 probably benign Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk16 A G 14: 20,265,279 V72A probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matr3 T A 18: 35,588,325 probably benign Het
Med13l T G 5: 118,728,833 F651V probably benign Het
Mfsd11 T C 11: 116,873,914 V388A probably benign Het
Mki67 C T 7: 135,698,065 V1747I possibly damaging Het
Mms22l T C 4: 24,535,936 probably benign Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1234 A G 2: 89,363,009 V140A probably benign Het
Olfr376 T A 11: 73,375,601 V287E probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
P4ha1 A G 10: 59,371,037 E523G probably damaging Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Pigr G A 1: 130,846,662 probably benign Het
Pkd1l1 A T 11: 8,836,197 probably benign Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Rgs3 A G 4: 62,702,147 I537V probably damaging Het
Rhobtb2 T G 14: 69,796,444 D444A probably damaging Het
Rnf40 T C 7: 127,591,784 S314P probably damaging Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Samd3 A G 10: 26,263,986 probably benign Het
Sec61a2 A G 2: 5,873,736 probably benign Het
Serpina3m G A 12: 104,389,322 A83T probably damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Sez6 C T 11: 77,972,932 T439I probably damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Spg11 C T 2: 122,060,207 V2044M probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Suclg2 T C 6: 95,589,094 probably benign Het
Tlr4 A T 4: 66,839,444 H158L probably damaging Het
Tmem131 A G 1: 36,812,271 V966A possibly damaging Het
Tram1l1 T A 3: 124,321,986 I265N probably damaging Het
Trim58 T A 11: 58,640,667 F67Y possibly damaging Het
Ttc19 A G 11: 62,281,824 Q74R probably benign Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn2r16 A G 5: 109,339,258 Y115C possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp451 A G 1: 33,782,193 F151L probably damaging Het
Zfp451 G A 1: 33,783,856 P99S probably benign Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp804b A G 5: 6,769,748 V1069A probably benign Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Specc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Specc1l APN 10 75246221 missense probably benign 0.12
IGL01638:Specc1l APN 10 75246205 nonsense probably null
IGL01970:Specc1l APN 10 75245761 missense probably damaging 1.00
IGL02539:Specc1l APN 10 75267508 missense probably benign 0.39
IGL02737:Specc1l APN 10 75246324 missense probably damaging 0.99
IGL02941:Specc1l APN 10 75241188 missense probably benign 0.10
R0305:Specc1l UTSW 10 75245829 missense probably damaging 1.00
R0374:Specc1l UTSW 10 75248459 missense probably damaging 0.99
R0402:Specc1l UTSW 10 75246426 missense probably damaging 1.00
R1456:Specc1l UTSW 10 75246284 missense probably damaging 0.98
R1508:Specc1l UTSW 10 75307238 missense probably benign 0.00
R1861:Specc1l UTSW 10 75309859 missense probably damaging 1.00
R1869:Specc1l UTSW 10 75261825 missense probably damaging 1.00
R1930:Specc1l UTSW 10 75309824 missense probably damaging 1.00
R2021:Specc1l UTSW 10 75267591 critical splice donor site probably null
R2209:Specc1l UTSW 10 75246576 missense probably damaging 1.00
R2271:Specc1l UTSW 10 75245604 missense probably damaging 1.00
R2937:Specc1l UTSW 10 75259131 missense probably damaging 0.98
R4415:Specc1l UTSW 10 75246328 missense possibly damaging 0.92
R4758:Specc1l UTSW 10 75246348 missense probably damaging 0.99
R5344:Specc1l UTSW 10 75246173 missense possibly damaging 0.84
R5383:Specc1l UTSW 10 75246705 missense possibly damaging 0.86
R5426:Specc1l UTSW 10 75267550 missense probably benign 0.21
R5774:Specc1l UTSW 10 75245400 missense probably damaging 1.00
R5788:Specc1l UTSW 10 75276921 missense probably damaging 1.00
R6101:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6105:Specc1l UTSW 10 75248632 missense probably damaging 1.00
R6136:Specc1l UTSW 10 75246660 missense probably benign 0.38
R6345:Specc1l UTSW 10 75248488 missense probably damaging 0.99
R6459:Specc1l UTSW 10 75246167 missense probably damaging 1.00
R6641:Specc1l UTSW 10 75246549 missense probably damaging 1.00
R6996:Specc1l UTSW 10 75246279 missense probably benign 0.23
R7100:Specc1l UTSW 10 75245495 missense probably benign 0.21
R7475:Specc1l UTSW 10 75246447 missense possibly damaging 0.59
R7545:Specc1l UTSW 10 75245087 missense probably benign 0.00
R7615:Specc1l UTSW 10 75263286 missense probably benign 0.02
R7635:Specc1l UTSW 10 75276804 missense probably damaging 1.00
R7640:Specc1l UTSW 10 75257869 missense probably damaging 1.00
R7682:Specc1l UTSW 10 75245802 missense probably damaging 0.99
R7711:Specc1l UTSW 10 75230808 missense probably benign 0.02
R7742:Specc1l UTSW 10 75246417 missense probably benign 0.01
R7847:Specc1l UTSW 10 75309836 missense probably damaging 0.99
R8015:Specc1l UTSW 10 75241068 missense probably benign 0.17
R8030:Specc1l UTSW 10 75248555 missense probably damaging 1.00
X0021:Specc1l UTSW 10 75274040 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCATTAGTGAGGACCATTGTG -3'
(R):5'- TCCAGGTTGTCCATGGAGTTAC -3'

Sequencing Primer
(F):5'- CATTAGTGAGGACCATTGTGAAGGTG -3'
(R):5'- ACTGTGCTGATGGTCCATGAG -3'
Posted On2014-07-14