Incidental Mutation 'R1929:Dnah9'
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Namedynein, axonemal, heavy chain 9
SynonymsD11Ertd686e, Dnahc9
MMRRC Submission 039947-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R1929 (G1)
Quality Score225
Status Validated
Chromosomal Location65831282-66168551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65976398 bp
Amino Acid Change Serine to Glycine at position 2785 (S2785G)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
Predicted Effect probably benign
Transcript: ENSMUST00000080665
AA Change: S2785G

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: S2785G

Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152386
AA Change: S334G
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: S334G

Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Amdhd2 T C 17: 24,157,886 probably null Het
Angel1 A C 12: 86,702,319 L656V probably damaging Het
Ankrd12 G A 17: 65,986,686 S584L possibly damaging Het
Apbb2 T A 5: 66,307,615 N679Y probably benign Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Bnip3 T G 7: 138,894,630 silent Het
Btc T C 5: 91,362,401 Y111C probably damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cd2bp2 T C 7: 127,193,878 D324G probably benign Het
Cdc20b A G 13: 113,071,917 T216A probably benign Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Cenpv T C 11: 62,525,233 E230G probably benign Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27b1 T A 10: 127,048,312 V11D probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Dtx3l A T 16: 35,933,689 D182E possibly damaging Het
Efcab6 A G 15: 83,892,962 probably benign Het
Elac2 T A 11: 64,979,189 S27T probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgd6 T C 10: 94,045,006 V574A probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Focad A G 4: 88,342,212 N902D unknown Het
Focad A G 4: 88,397,179 S1525G probably benign Het
Fras1 T C 5: 96,667,437 W1338R probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Gm10076 T G 14: 105,681,870 noncoding transcript Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Gm5698 T G 1: 30,977,961 D3A probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gngt2 C T 11: 95,845,146 probably benign Het
Gsdma T C 11: 98,671,367 probably null Het
Gtf2h3 A T 5: 124,602,199 probably benign Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk16 A G 14: 20,265,279 V72A probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matr3 T A 18: 35,588,325 probably benign Het
Med13l T G 5: 118,728,833 F651V probably benign Het
Mfsd11 T C 11: 116,873,914 V388A probably benign Het
Mki67 C T 7: 135,698,065 V1747I possibly damaging Het
Mms22l T C 4: 24,535,936 probably benign Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1234 A G 2: 89,363,009 V140A probably benign Het
Olfr376 T A 11: 73,375,601 V287E probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
P4ha1 A G 10: 59,371,037 E523G probably damaging Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Pigr G A 1: 130,846,662 probably benign Het
Pkd1l1 A T 11: 8,836,197 probably benign Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Rgs3 A G 4: 62,702,147 I537V probably damaging Het
Rhobtb2 T G 14: 69,796,444 D444A probably damaging Het
Rnf40 T C 7: 127,591,784 S314P probably damaging Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Samd3 A G 10: 26,263,986 probably benign Het
Sec61a2 A G 2: 5,873,736 probably benign Het
Serpina3m G A 12: 104,389,322 A83T probably damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Sez6 C T 11: 77,972,932 T439I probably damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Spg11 C T 2: 122,060,207 V2044M probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Suclg2 T C 6: 95,589,094 probably benign Het
Tlr4 A T 4: 66,839,444 H158L probably damaging Het
Tmem131 A G 1: 36,812,271 V966A possibly damaging Het
Tram1l1 T A 3: 124,321,986 I265N probably damaging Het
Trim58 T A 11: 58,640,667 F67Y possibly damaging Het
Ttc19 A G 11: 62,281,824 Q74R probably benign Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn2r16 A G 5: 109,339,258 Y115C possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp451 A G 1: 33,782,193 F151L probably damaging Het
Zfp451 G A 1: 33,783,856 P99S probably benign Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp804b A G 5: 6,769,748 V1069A probably benign Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65841238 splice site probably benign
IGL00805:Dnah9 APN 11 65881695 missense probably benign 0.00
IGL00826:Dnah9 APN 11 65989942 missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65849980 missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66072056 missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66080571 missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66155459 missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65955717 missense probably benign 0.14
IGL01537:Dnah9 APN 11 65947680 missense probably benign
IGL01565:Dnah9 APN 11 66033829 missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66118830 missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65831615 nonsense probably null
IGL01625:Dnah9 APN 11 66044645 missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66118829 missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66108126 missense probably benign 0.33
IGL01896:Dnah9 APN 11 66130666 missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66075034 splice site probably benign
IGL01923:Dnah9 APN 11 66125235 splice site probably benign
IGL02059:Dnah9 APN 11 66072958 missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66061045 missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66117492 missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65927700 missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66080488 splice site probably benign
IGL02325:Dnah9 APN 11 65834217 missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66125153 missense probably benign
IGL02440:Dnah9 APN 11 65955246 missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65947618 nonsense probably null
IGL02496:Dnah9 APN 11 66029363 missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65927601 missense probably benign 0.02
IGL02718:Dnah9 APN 11 65886640 missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66040346 missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66037744 splice site probably benign
IGL02859:Dnah9 APN 11 65881619 splice site probably benign
IGL02864:Dnah9 APN 11 66061003 missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66118967 missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65855272 missense probably damaging 0.98
IGL02987:Dnah9 APN 11 65841273 missense probably benign 0.23
IGL03160:Dnah9 APN 11 66108054 missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65981241 missense probably benign 0.13
IGL03180:Dnah9 APN 11 65886639 missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65947542 missense probably damaging 1.00
anarchy UTSW 11 65955248 missense probably damaging 0.99
sacco UTSW 11 66168079 missense possibly damaging 0.82
Tweed UTSW 11 66072072 missense probably damaging 0.99
vanzetti UTSW 11 65855372 nonsense probably null
IGL02837:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 66005013 missense probably benign 0.44
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0070:Dnah9 UTSW 11 66160040 missense probably benign 0.10
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0180:Dnah9 UTSW 11 66147290 missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R0230:Dnah9 UTSW 11 65855315 missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65911852 missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65911789 critical splice donor site probably null
R0288:Dnah9 UTSW 11 66025134 critical splice donor site probably null
R0309:Dnah9 UTSW 11 66026972 splice site probably benign
R0356:Dnah9 UTSW 11 66130562 critical splice donor site probably null
R0403:Dnah9 UTSW 11 66084789 missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66108135 missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65918713 splice site probably benign
R0496:Dnah9 UTSW 11 66075135 missense probably null 1.00
R0557:Dnah9 UTSW 11 66084666 missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65990489 missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66118877 missense probably benign 0.02
R0599:Dnah9 UTSW 11 65965689 missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65841333 missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66085458 missense probably benign 0.01
R0715:Dnah9 UTSW 11 66081248 splice site probably benign
R0726:Dnah9 UTSW 11 65965681 missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66107898 missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66155530 missense probably benign 0.30
R0792:Dnah9 UTSW 11 65896001 missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66005176 missense probably benign 0.00
R0973:Dnah9 UTSW 11 66005837 splice site probably null
R0974:Dnah9 UTSW 11 66005837 splice site probably null
R1055:Dnah9 UTSW 11 66160011 missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66084877 missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66084612 critical splice donor site probably null
R1225:Dnah9 UTSW 11 65871060 missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65927588 missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65955747 missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65874132 missense probably benign 0.22
R1447:Dnah9 UTSW 11 66108482 missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65927786 missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1486:Dnah9 UTSW 11 65834272 missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65881761 missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66112330 missense probably benign
R1617:Dnah9 UTSW 11 65895921 missense probably damaging 1.00
R1623:Dnah9 UTSW 11 66037637 missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66085267 missense probably benign 0.05
R1671:Dnah9 UTSW 11 65927963 missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65954824 nonsense probably null
R1701:Dnah9 UTSW 11 65911924 missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66085195 missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65915154 missense probably benign 0.11
R1718:Dnah9 UTSW 11 66168079 missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65981222 missense probably benign 0.31
R1784:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66119594 critical splice donor site probably null
R1801:Dnah9 UTSW 11 65955297 missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65850061 missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66118841 missense probably benign 0.10
R1840:Dnah9 UTSW 11 65834198 nonsense probably null
R1847:Dnah9 UTSW 11 65834386 missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66037490 missense probably benign 0.16
R1969:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65955338 missense probably benign 0.11
R2049:Dnah9 UTSW 11 66044683 missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66145435 missense probably benign 0.31
R2104:Dnah9 UTSW 11 66061124 missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66037585 missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66117483 missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66072779 missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65859499 missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2272:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2396:Dnah9 UTSW 11 66085158 missense probably benign 0.01
R2398:Dnah9 UTSW 11 65915203 missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66095415 nonsense probably null
R2419:Dnah9 UTSW 11 66095415 nonsense probably null
R2510:Dnah9 UTSW 11 66005169 missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66033925 missense probably benign 0.00
R2875:Dnah9 UTSW 11 66168461 missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66117588 missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3237:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3433:Dnah9 UTSW 11 66075112 missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66156908 nonsense probably null
R3820:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3821:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3822:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3861:Dnah9 UTSW 11 66052994 splice site probably benign
R3918:Dnah9 UTSW 11 65870974 missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65834464 missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66133635 missense probably benign 0.03
R4072:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4076:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4097:Dnah9 UTSW 11 65990459 missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65981214 missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66118749 missense probably benign 0.00
R4434:Dnah9 UTSW 11 66108075 missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65881641 missense probably benign 0.07
R4452:Dnah9 UTSW 11 66027082 missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66147389 missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66040392 missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66168152 missense probably benign
R4655:Dnah9 UTSW 11 65955732 missense probably benign 0.00
R4667:Dnah9 UTSW 11 66155531 missense probably benign
R4718:Dnah9 UTSW 11 66085473 missense probably benign
R4720:Dnah9 UTSW 11 66076358 missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65927726 missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65874124 nonsense probably null
R4963:Dnah9 UTSW 11 66084611 splice site probably null
R5074:Dnah9 UTSW 11 65850040 missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66084666 missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66112333 missense probably benign 0.34
R5364:Dnah9 UTSW 11 65881696 missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66029354 missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66029356 missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66095314 nonsense probably null
R5541:Dnah9 UTSW 11 66145336 missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65881740 missense probably benign 0.00
R5576:Dnah9 UTSW 11 65834096 splice site probably null
R5648:Dnah9 UTSW 11 65927755 missense probably benign 0.00
R5653:Dnah9 UTSW 11 65849980 missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66025223 missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65955239 missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66126601 missense probably benign 0.01
R5831:Dnah9 UTSW 11 66108121 missense probably benign 0.00
R5847:Dnah9 UTSW 11 66095240 frame shift probably null
R5870:Dnah9 UTSW 11 66085210 missense probably benign 0.01
R5902:Dnah9 UTSW 11 66025187 missense probably benign 0.08
R5918:Dnah9 UTSW 11 65834199 missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65834481 missense probably damaging 1.00
R6065:Dnah9 UTSW 11 65855338 missense probably benign 0.05
R6065:Dnah9 UTSW 11 66145397 missense possibly damaging 0.65
R6086:Dnah9 UTSW 11 65989915 missense probably damaging 0.99
R6086:Dnah9 UTSW 11 66085174 missense probably benign
R6102:Dnah9 UTSW 11 65990516 missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66147399 missense probably benign
R6154:Dnah9 UTSW 11 65855338 missense probably benign 0.00
R6262:Dnah9 UTSW 11 65881805 splice site probably null
R6265:Dnah9 UTSW 11 66168094 missense probably benign 0.04
R6290:Dnah9 UTSW 11 65841375 missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66037693 missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65955248 missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66168281 missense probably benign 0.37
R6582:Dnah9 UTSW 11 66061097 missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65955366 missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66072739 critical splice donor site probably null
R6812:Dnah9 UTSW 11 65981329 missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66117626 missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66085149 missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66076341 missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66107909 missense probably benign 0.37
R7021:Dnah9 UTSW 11 65981231 missense probably benign
R7161:Dnah9 UTSW 11 65855372 nonsense probably null
R7175:Dnah9 UTSW 11 66133637 missense probably benign 0.03
R7199:Dnah9 UTSW 11 66118944 missense probably benign 0.04
R7231:Dnah9 UTSW 11 65965647 missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65990476 missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65989851 missense probably benign 0.00
R7350:Dnah9 UTSW 11 66080578 missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66117407 critical splice donor site probably null
R7427:Dnah9 UTSW 11 65955219 missense probably benign
R7477:Dnah9 UTSW 11 65992731 missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65841414 missense probably benign 0.01
R7521:Dnah9 UTSW 11 65989837 missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66125215 missense probably benign 0.43
R7659:Dnah9 UTSW 11 65989780 missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66118958 missense probably damaging 1.00
R7749:Dnah9 UTSW 11 65911830 missense probably damaging 1.00
R7792:Dnah9 UTSW 11 65850013 missense probably damaging 1.00
R7808:Dnah9 UTSW 11 66005805 nonsense probably null
R7814:Dnah9 UTSW 11 66005660 missense probably damaging 1.00
R7818:Dnah9 UTSW 11 66025211 missense possibly damaging 0.64
R7890:Dnah9 UTSW 11 66072072 missense probably damaging 0.99
R7976:Dnah9 UTSW 11 65841401 missense possibly damaging 0.91
R8121:Dnah9 UTSW 11 66017375 missense probably benign 0.02
R8232:Dnah9 UTSW 11 65855323 missense possibly damaging 0.91
R8311:Dnah9 UTSW 11 65989818 missense probably benign 0.00
R8326:Dnah9 UTSW 11 66117626 missense probably benign 0.01
R8338:Dnah9 UTSW 11 65841241 critical splice donor site probably null
R8356:Dnah9 UTSW 11 66156938 missense probably damaging 0.99
R8456:Dnah9 UTSW 11 66156938 missense probably damaging 0.99
R8468:Dnah9 UTSW 11 65831730 missense probably benign 0.00
R8721:Dnah9 UTSW 11 66095298 missense probably damaging 1.00
R8747:Dnah9 UTSW 11 65927990 missense possibly damaging 0.69
R8798:Dnah9 UTSW 11 65905231 missense probably damaging 0.99
R8806:Dnah9 UTSW 11 65859483 missense probably damaging 1.00
R8826:Dnah9 UTSW 11 65849916 missense probably benign 0.13
R8837:Dnah9 UTSW 11 65855234 missense possibly damaging 0.72
R8886:Dnah9 UTSW 11 66053014 missense probably damaging 1.00
R8887:Dnah9 UTSW 11 65855384 missense probably benign 0.01
R8921:Dnah9 UTSW 11 65911921 missense probably benign
R8933:Dnah9 UTSW 11 65855252 missense possibly damaging 0.88
R8949:Dnah9 UTSW 11 66168400 missense possibly damaging 0.91
V3553:Dnah9 UTSW 11 65970076 missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66085479 missense probably benign 0.07
X0028:Dnah9 UTSW 11 65990452 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65895972 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65927853 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 65970084 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 66037474 missense probably damaging 1.00
Z1176:Dnah9 UTSW 11 66072835 missense probably damaging 1.00
Z1177:Dnah9 UTSW 11 66126650 missense probably damaging 1.00
Z1186:Dnah9 UTSW 11 66085174 missense probably benign
Z1186:Dnah9 UTSW 11 66147381 missense probably benign
Z1187:Dnah9 UTSW 11 66085174 missense probably benign
Z1187:Dnah9 UTSW 11 66147381 missense probably benign
Z1188:Dnah9 UTSW 11 66085174 missense probably benign
Z1188:Dnah9 UTSW 11 66147381 missense probably benign
Z1189:Dnah9 UTSW 11 66085174 missense probably benign
Z1189:Dnah9 UTSW 11 66147381 missense probably benign
Z1190:Dnah9 UTSW 11 66085174 missense probably benign
Z1190:Dnah9 UTSW 11 66147381 missense probably benign
Z1191:Dnah9 UTSW 11 66085174 missense probably benign
Z1191:Dnah9 UTSW 11 66147381 missense probably benign
Z1192:Dnah9 UTSW 11 66085174 missense probably benign
Z1192:Dnah9 UTSW 11 66147381 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-07-14