Incidental Mutation 'R1929:Efcab6'
Institutional Source Beutler Lab
Gene Symbol Efcab6
Ensembl Gene ENSMUSG00000022441
Gene NameEF-hand calcium binding domain 6
Synonyms4931407K02Rik, 4932408N08Rik
MMRRC Submission 039947-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1929 (G1)
Quality Score225
Status Validated
Chromosomal Location83866712-84065379 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 83892962 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000156187]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144169
Predicted Effect probably benign
Transcript: ENSMUST00000156187
SMART Domains Protein: ENSMUSP00000114909
Gene: ENSMUSG00000022441

EFh 100 128 9.33e-2 SMART
low complexity region 162 172 N/A INTRINSIC
EFh 201 229 5e-2 SMART
EFh 325 353 1.59e1 SMART
EFh 532 560 1.17e2 SMART
low complexity region 598 607 N/A INTRINSIC
EFh 659 687 8.82e1 SMART
EFh 767 795 3.71e0 SMART
low complexity region 802 816 N/A INTRINSIC
EFh 909 937 2.46e-1 SMART
low complexity region 962 977 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
EFh 1090 1118 2.09e0 SMART
low complexity region 1131 1136 N/A INTRINSIC
EFh 1197 1225 2e1 SMART
Blast:EFh 1233 1261 1e-9 BLAST
EFh 1342 1370 3.48e-1 SMART
EFh 1453 1481 2.49e0 SMART
Blast:EFh 1489 1516 6e-9 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which directly binds the oncogene DJ-1 and androgen receptor to form a ternary complex in cells. This binding protein recruits histone-deacetylase complexes in order to repress transcription activity of androgen receptor. This protein may also play a role in spermatogenesis and fertilization. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Amdhd2 T C 17: 24,157,886 probably null Het
Angel1 A C 12: 86,702,319 L656V probably damaging Het
Ankrd12 G A 17: 65,986,686 S584L possibly damaging Het
Apbb2 T A 5: 66,307,615 N679Y probably benign Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Bnip3 T G 7: 138,894,630 silent Het
Btc T C 5: 91,362,401 Y111C probably damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cd2bp2 T C 7: 127,193,878 D324G probably benign Het
Cdc20b A G 13: 113,071,917 T216A probably benign Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Cenpv T C 11: 62,525,233 E230G probably benign Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27b1 T A 10: 127,048,312 V11D probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 65,976,398 S2785G probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Dtx3l A T 16: 35,933,689 D182E possibly damaging Het
Elac2 T A 11: 64,979,189 S27T probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgd6 T C 10: 94,045,006 V574A probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Focad A G 4: 88,342,212 N902D unknown Het
Focad A G 4: 88,397,179 S1525G probably benign Het
Fras1 T C 5: 96,667,437 W1338R probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Gm10076 T G 14: 105,681,870 noncoding transcript Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Gm5698 T G 1: 30,977,961 D3A probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gngt2 C T 11: 95,845,146 probably benign Het
Gsdma T C 11: 98,671,367 probably null Het
Gtf2h3 A T 5: 124,602,199 probably benign Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Kcnk16 A G 14: 20,265,279 V72A probably damaging Het
Lipa T A 19: 34,510,890 R119* probably null Het
Matr3 T A 18: 35,588,325 probably benign Het
Med13l T G 5: 118,728,833 F651V probably benign Het
Mfsd11 T C 11: 116,873,914 V388A probably benign Het
Mki67 C T 7: 135,698,065 V1747I possibly damaging Het
Mms22l T C 4: 24,535,936 probably benign Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1234 A G 2: 89,363,009 V140A probably benign Het
Olfr376 T A 11: 73,375,601 V287E probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
P4ha1 A G 10: 59,371,037 E523G probably damaging Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Pigr G A 1: 130,846,662 probably benign Het
Pkd1l1 A T 11: 8,836,197 probably benign Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Rgs3 A G 4: 62,702,147 I537V probably damaging Het
Rhobtb2 T G 14: 69,796,444 D444A probably damaging Het
Rnf40 T C 7: 127,591,784 S314P probably damaging Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Samd3 A G 10: 26,263,986 probably benign Het
Sec61a2 A G 2: 5,873,736 probably benign Het
Serpina3m G A 12: 104,389,322 A83T probably damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Sez6 C T 11: 77,972,932 T439I probably damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Spg11 C T 2: 122,060,207 V2044M probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Suclg2 T C 6: 95,589,094 probably benign Het
Tlr4 A T 4: 66,839,444 H158L probably damaging Het
Tmem131 A G 1: 36,812,271 V966A possibly damaging Het
Tram1l1 T A 3: 124,321,986 I265N probably damaging Het
Trim58 T A 11: 58,640,667 F67Y possibly damaging Het
Ttc19 A G 11: 62,281,824 Q74R probably benign Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn2r16 A G 5: 109,339,258 Y115C possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp451 A G 1: 33,782,193 F151L probably damaging Het
Zfp451 G A 1: 33,783,856 P99S probably benign Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp804b A G 5: 6,769,748 V1069A probably benign Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Efcab6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Efcab6 APN 15 84018642 missense probably benign 0.09
IGL00946:Efcab6 APN 15 84018696 missense probably benign 0.19
IGL01063:Efcab6 APN 15 84054512 start codon destroyed probably null 0.53
IGL01330:Efcab6 APN 15 84044300 missense probably benign 0.26
IGL01372:Efcab6 APN 15 84044304 missense possibly damaging 0.62
IGL01644:Efcab6 APN 15 84033072 missense probably damaging 0.97
IGL02175:Efcab6 APN 15 83896100 missense probably damaging 0.98
IGL02449:Efcab6 APN 15 84010033 missense probably benign 0.00
IGL02514:Efcab6 APN 15 84032942 missense possibly damaging 0.91
IGL02514:Efcab6 APN 15 83871311 splice site probably benign
IGL02538:Efcab6 APN 15 84054521 start gained probably benign
IGL02623:Efcab6 APN 15 83879448 missense probably damaging 0.99
IGL02735:Efcab6 APN 15 83899697 missense probably damaging 1.00
IGL03139:Efcab6 APN 15 83952221 missense probably benign 0.04
IGL03274:Efcab6 APN 15 83868249 missense probably damaging 1.00
IGL03400:Efcab6 APN 15 83867045 utr 3 prime probably benign
P0045:Efcab6 UTSW 15 83918199 missense probably damaging 1.00
PIT4445001:Efcab6 UTSW 15 83904267 missense probably benign 0.03
PIT4486001:Efcab6 UTSW 15 83973313 missense probably benign 0.00
PIT4618001:Efcab6 UTSW 15 83983446 missense probably benign 0.25
R0520:Efcab6 UTSW 15 83950046 missense probably benign 0.00
R0575:Efcab6 UTSW 15 83967700 missense probably benign 0.28
R0648:Efcab6 UTSW 15 83933064 splice site probably benign
R0894:Efcab6 UTSW 15 83918292 missense probably benign 0.00
R0975:Efcab6 UTSW 15 83973331 missense probably benign 0.00
R1238:Efcab6 UTSW 15 83933137 missense probably benign 0.06
R1625:Efcab6 UTSW 15 83947638 missense probably benign
R1651:Efcab6 UTSW 15 83870993 missense possibly damaging 0.50
R1691:Efcab6 UTSW 15 83933206 missense probably benign 0.01
R1844:Efcab6 UTSW 15 83967621 missense possibly damaging 0.47
R1983:Efcab6 UTSW 15 83892962 splice site probably benign
R2100:Efcab6 UTSW 15 83892967 splice site probably null
R2271:Efcab6 UTSW 15 83946999 missense probably benign
R2329:Efcab6 UTSW 15 83950048 missense possibly damaging 0.90
R3618:Efcab6 UTSW 15 83950069 missense probably benign 0.00
R3687:Efcab6 UTSW 15 83871278 nonsense probably null
R3688:Efcab6 UTSW 15 83871278 nonsense probably null
R4212:Efcab6 UTSW 15 83892863 missense probably damaging 1.00
R4223:Efcab6 UTSW 15 83867108 missense probably damaging 1.00
R4459:Efcab6 UTSW 15 83904289 missense probably damaging 1.00
R4578:Efcab6 UTSW 15 83933168 missense probably benign 0.00
R4600:Efcab6 UTSW 15 83946925 missense probably benign
R5174:Efcab6 UTSW 15 84054486 missense probably benign
R5260:Efcab6 UTSW 15 83945123 missense probably benign 0.01
R5576:Efcab6 UTSW 15 83950000 missense probably benign 0.05
R5718:Efcab6 UTSW 15 83904238 missense probably damaging 1.00
R5797:Efcab6 UTSW 15 83924277 missense possibly damaging 0.82
R6027:Efcab6 UTSW 15 83967721 missense probably benign
R6110:Efcab6 UTSW 15 83879634 missense possibly damaging 0.69
R6132:Efcab6 UTSW 15 84032972 missense probably damaging 1.00
R6166:Efcab6 UTSW 15 83896115 missense probably benign 0.01
R6228:Efcab6 UTSW 15 83967624 missense possibly damaging 0.67
R6341:Efcab6 UTSW 15 83935938 missense possibly damaging 0.65
R6445:Efcab6 UTSW 15 83868357 missense probably damaging 1.00
R6494:Efcab6 UTSW 15 84044322 critical splice acceptor site probably null
R6611:Efcab6 UTSW 15 83892835 missense possibly damaging 0.68
R7392:Efcab6 UTSW 15 83988951 missense probably benign 0.39
R7599:Efcab6 UTSW 15 83870988 missense probably damaging 1.00
R7711:Efcab6 UTSW 15 83949924 missense probably benign 0.00
R7873:Efcab6 UTSW 15 84018625 critical splice donor site probably null
R8031:Efcab6 UTSW 15 83983498 missense possibly damaging 0.90
R8075:Efcab6 UTSW 15 83967623 missense probably damaging 0.99
R8209:Efcab6 UTSW 15 83904255 missense probably benign 0.04
R8226:Efcab6 UTSW 15 83904255 missense probably benign 0.04
R8710:Efcab6 UTSW 15 84018648 missense probably benign 0.00
R8869:Efcab6 UTSW 15 84044231 missense probably damaging 0.97
R8890:Efcab6 UTSW 15 83945148 missense probably damaging 1.00
X0019:Efcab6 UTSW 15 83879483 missense possibly damaging 0.92
X0064:Efcab6 UTSW 15 83983493 missense probably benign 0.08
Z1088:Efcab6 UTSW 15 83955009 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2014-07-14