Incidental Mutation 'R1929:Myo5b'
ID 215230
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 039947-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R1929 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74866996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 1382 (L1382F)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: L1382F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: L1382F

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: L1408F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: L1408F

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154986
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,337,866 (GRCm39) E160V probably damaging Het
Amdhd2 T C 17: 24,376,860 (GRCm39) probably null Het
Angel1 A C 12: 86,749,093 (GRCm39) L656V probably damaging Het
Ankrd12 G A 17: 66,293,681 (GRCm39) S584L possibly damaging Het
Apbb2 T A 5: 66,464,958 (GRCm39) N679Y probably benign Het
Arid3c T A 4: 41,724,744 (GRCm39) I364F probably damaging Het
Bcan T A 3: 87,900,401 (GRCm39) S611C probably damaging Het
Bnip3 T G 7: 138,496,359 (GRCm39) silent Het
Btc T C 5: 91,510,260 (GRCm39) Y111C probably damaging Het
Carnmt1 T C 19: 18,680,734 (GRCm39) L336P probably damaging Het
Ccdc83 C T 7: 89,873,285 (GRCm39) V357I probably damaging Het
Cd2bp2 T C 7: 126,793,050 (GRCm39) D324G probably benign Het
Cdc20b A G 13: 113,208,451 (GRCm39) T216A probably benign Het
Cdk17 T C 10: 93,064,540 (GRCm39) Y270H probably damaging Het
Cenpv T C 11: 62,416,059 (GRCm39) E230G probably benign Het
Chst11 T C 10: 83,027,004 (GRCm39) Y144H probably damaging Het
Cracr2a T A 6: 127,584,261 (GRCm39) F107I probably damaging Het
Cyfip1 G T 7: 55,549,705 (GRCm39) R624L probably null Het
Cyp27b1 T A 10: 126,884,181 (GRCm39) V11D probably damaging Het
Ddc T C 11: 11,785,764 (GRCm39) N308D probably damaging Het
Des T G 1: 75,340,137 (GRCm39) M348R probably damaging Het
Dis3l T A 9: 64,238,165 (GRCm39) D109V probably damaging Het
Dnah3 T A 7: 119,574,352 (GRCm39) I2136F probably benign Het
Dnah9 T C 11: 65,867,224 (GRCm39) S2785G probably benign Het
Dop1a T G 9: 86,376,471 (GRCm39) V235G probably damaging Het
Dtx3l A T 16: 35,754,059 (GRCm39) D182E possibly damaging Het
Efcab6 A G 15: 83,777,163 (GRCm39) probably benign Het
Elac2 T A 11: 64,870,015 (GRCm39) S27T probably benign Het
Emsy T G 7: 98,275,830 (GRCm39) K352N probably damaging Het
Erbb4 T C 1: 68,238,047 (GRCm39) N814S probably damaging Het
Fgd6 T C 10: 93,880,868 (GRCm39) V574A probably benign Het
Filip1 T C 9: 79,727,212 (GRCm39) E469G probably damaging Het
Fmo1 A T 1: 162,661,424 (GRCm39) D286E probably damaging Het
Fmo4 A T 1: 162,626,616 (GRCm39) I310N possibly damaging Het
Focad A G 4: 88,260,449 (GRCm39) N902D unknown Het
Focad A G 4: 88,315,416 (GRCm39) S1525G probably benign Het
Fras1 T C 5: 96,815,296 (GRCm39) W1338R probably benign Het
Fry A G 5: 150,324,389 (GRCm39) I1151V probably null Het
Garin5b T A 7: 4,761,186 (GRCm39) T509S probably benign Het
Gm10076 T G 14: 105,919,304 (GRCm39) noncoding transcript Het
Gm5698 T G 1: 31,017,042 (GRCm39) D3A probably damaging Het
Gngt2 C T 11: 95,735,972 (GRCm39) probably benign Het
Gsdma T C 11: 98,562,193 (GRCm39) probably null Het
Gtf2h3 A T 5: 124,740,262 (GRCm39) probably benign Het
Hkdc1 T C 10: 62,253,677 (GRCm39) T35A probably benign Het
Irs1 T C 1: 82,266,180 (GRCm39) S679G probably benign Het
Itpr1 T A 6: 108,470,716 (GRCm39) C2214S probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Kcnk16 A G 14: 20,315,347 (GRCm39) V72A probably damaging Het
Lipa T A 19: 34,488,290 (GRCm39) R119* probably null Het
Matr3 T A 18: 35,721,378 (GRCm39) probably benign Het
Med13l T G 5: 118,866,898 (GRCm39) F651V probably benign Het
Mfsd11 T C 11: 116,764,740 (GRCm39) V388A probably benign Het
Mki67 C T 7: 135,299,794 (GRCm39) V1747I possibly damaging Het
Mms22l T C 4: 24,535,936 (GRCm39) probably benign Het
Msh5 A G 17: 35,263,366 (GRCm39) I154T probably benign Het
Ncbp2 T C 16: 31,775,769 (GRCm39) Y138H probably damaging Het
Ndufv1 C A 19: 4,058,347 (GRCm39) R359L probably benign Het
Ntrk3 A C 7: 78,166,471 (GRCm39) probably null Het
Or1e1c T A 11: 73,266,427 (GRCm39) V287E probably damaging Het
Or4a15 A G 2: 89,193,353 (GRCm39) V140A probably benign Het
Or8b12i T A 9: 20,082,705 (GRCm39) H54L possibly damaging Het
P4ha1 A G 10: 59,206,859 (GRCm39) E523G probably damaging Het
Per3 T A 4: 151,103,342 (GRCm39) Y530F probably damaging Het
Pes1 C A 11: 3,919,524 (GRCm39) L66I probably damaging Het
Pigr G A 1: 130,774,399 (GRCm39) probably benign Het
Pkd1l1 A T 11: 8,786,197 (GRCm39) probably benign Het
Plch1 T A 3: 63,651,956 (GRCm39) K378N probably damaging Het
Plxnb1 T C 9: 108,931,776 (GRCm39) probably null Het
Pramel22 G A 4: 143,380,712 (GRCm39) T437I probably damaging Het
Prkdc A G 16: 15,472,681 (GRCm39) probably null Het
Prrc1 G T 18: 57,514,718 (GRCm39) D312Y probably damaging Het
Psma5-ps A G 10: 85,149,595 (GRCm39) noncoding transcript Het
Rab3gap2 T A 1: 185,015,739 (GRCm39) probably null Het
Rgs3 A G 4: 62,620,384 (GRCm39) I537V probably damaging Het
Rhobtb2 T G 14: 70,033,893 (GRCm39) D444A probably damaging Het
Rnf40 T C 7: 127,190,956 (GRCm39) S314P probably damaging Het
Rngtt T A 4: 33,500,302 (GRCm39) C565* probably null Het
Samd3 A G 10: 26,139,884 (GRCm39) probably benign Het
Sec61a2 A G 2: 5,878,547 (GRCm39) probably benign Het
Serpina3m G A 12: 104,355,581 (GRCm39) A83T probably damaging Het
Serpinb13 A T 1: 106,926,756 (GRCm39) I251L possibly damaging Het
Sez6 C T 11: 77,863,758 (GRCm39) T439I probably damaging Het
Shc1 G A 3: 89,330,849 (GRCm39) G91S probably damaging Het
Slc26a2 A G 18: 61,331,650 (GRCm39) C594R possibly damaging Het
Specc1l C T 10: 75,081,438 (GRCm39) S278F probably damaging Het
Spg11 C T 2: 121,890,688 (GRCm39) V2044M probably damaging Het
Stx18 T A 5: 38,285,383 (GRCm39) probably null Het
Suclg2 T C 6: 95,566,075 (GRCm39) probably benign Het
Tlr4 A T 4: 66,757,681 (GRCm39) H158L probably damaging Het
Tmem131 A G 1: 36,851,352 (GRCm39) V966A possibly damaging Het
Tram1l1 T A 3: 124,115,635 (GRCm39) I265N probably damaging Het
Trim58 T A 11: 58,531,493 (GRCm39) F67Y possibly damaging Het
Ttc19 A G 11: 62,172,650 (GRCm39) Q74R probably benign Het
Usp7 T C 16: 8,516,333 (GRCm39) S649G probably benign Het
Vmn2r16 A G 5: 109,487,124 (GRCm39) Y115C possibly damaging Het
Zfp444 T C 7: 6,192,554 (GRCm39) C191R probably damaging Het
Zfp451 A G 1: 33,821,274 (GRCm39) F151L probably damaging Het
Zfp451 G A 1: 33,822,937 (GRCm39) P99S probably benign Het
Zfp729b A T 13: 67,740,352 (GRCm39) C648S probably damaging Het
Zfp799 A G 17: 33,040,777 (GRCm39) Y58H probably damaging Het
Zfp804b A G 5: 6,819,748 (GRCm39) V1069A probably benign Het
Zfp938 C T 10: 82,061,381 (GRCm39) G413D probably damaging Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8383:Myo5b UTSW 18 74,777,049 (GRCm39) missense probably benign 0.05
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TTATTGCTGGCAGAATGAACTCTG -3'
(R):5'- CTGCCAGCAGCTAAATTCTCC -3'

Sequencing Primer
(F):5'- GCAGAATGAACTCTGACTTGTCGC -3'
(R):5'- GCAGCTAAATTCTCCCATGACATG -3'
Posted On 2014-07-14