Incidental Mutation 'R1929:Lipa'
ID 215233
Institutional Source Beutler Lab
Gene Symbol Lipa
Ensembl Gene ENSMUSG00000024781
Gene Name lysosomal acid lipase A
Synonyms Lal, Lip1, Lip-1
MMRRC Submission 039947-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1929 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 34492318-34527474 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 34510890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 119 (R119*)
Ref Sequence ENSEMBL: ENSMUSP00000136967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049572] [ENSMUST00000178114]
AlphaFold Q9Z0M5
Predicted Effect probably null
Transcript: ENSMUST00000049572
AA Change: R119*
SMART Domains Protein: ENSMUSP00000053270
Gene: ENSMUSG00000024781
AA Change: R119*

Pfam:Abhydro_lipase 35 97 1.4e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.6e-11 PFAM
Pfam:Abhydrolase_6 80 382 2.2e-10 PFAM
Pfam:Abhydrolase_1 111 388 1e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178114
AA Change: R119*
SMART Domains Protein: ENSMUSP00000136967
Gene: ENSMUSG00000024781
AA Change: R119*

Pfam:Abhydro_lipase 35 97 1.3e-27 PFAM
Pfam:Abhydrolase_5 78 373 2.5e-11 PFAM
Pfam:Abhydrolase_1 78 379 3.9e-31 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 98% (107/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes lipase A, the lysosomal acid lipase (also known as cholesterol ester hydrolase). This enzyme functions in the lysosome to catalyze the hydrolysis of cholesteryl esters and triglycerides. Mutations in this gene can result in Wolman disease and cholesteryl ester storage disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous null mice show massive accumulation of triglycerides and cholesteryl esters in several organs, depletion of white and brown fat, hepatosplenomegaly, increased energy intake and plasma free fatty acid levels, insulin resistance, lung inflammation, alveolar destruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 A T 1: 165,510,297 E160V probably damaging Het
Amdhd2 T C 17: 24,157,886 probably null Het
Angel1 A C 12: 86,702,319 L656V probably damaging Het
Ankrd12 G A 17: 65,986,686 S584L possibly damaging Het
Apbb2 T A 5: 66,307,615 N679Y probably benign Het
Arid3c T A 4: 41,724,744 I364F probably damaging Het
Bcan T A 3: 87,993,094 S611C probably damaging Het
Bnip3 T G 7: 138,894,630 silent Het
Btc T C 5: 91,362,401 Y111C probably damaging Het
Carnmt1 T C 19: 18,703,370 L336P probably damaging Het
Ccdc83 C T 7: 90,224,077 V357I probably damaging Het
Cd2bp2 T C 7: 127,193,878 D324G probably benign Het
Cdc20b A G 13: 113,071,917 T216A probably benign Het
Cdk17 T C 10: 93,228,678 Y270H probably damaging Het
Cenpv T C 11: 62,525,233 E230G probably benign Het
Chst11 T C 10: 83,191,170 Y144H probably damaging Het
Cracr2a T A 6: 127,607,298 F107I probably damaging Het
Cyfip1 G T 7: 55,899,957 R624L probably null Het
Cyp27b1 T A 10: 127,048,312 V11D probably damaging Het
Ddc T C 11: 11,835,764 N308D probably damaging Het
Des T G 1: 75,363,493 M348R probably damaging Het
Dis3l T A 9: 64,330,883 D109V probably damaging Het
Dnah3 T A 7: 119,975,129 I2136F probably benign Het
Dnah9 T C 11: 65,976,398 S2785G probably benign Het
Dopey1 T G 9: 86,494,418 V235G probably damaging Het
Dtx3l A T 16: 35,933,689 D182E possibly damaging Het
Efcab6 A G 15: 83,892,962 probably benign Het
Elac2 T A 11: 64,979,189 S27T probably benign Het
Emsy T G 7: 98,626,623 K352N probably damaging Het
Erbb4 T C 1: 68,198,888 N814S probably damaging Het
Fam71e2 T A 7: 4,758,187 T509S probably benign Het
Fgd6 T C 10: 94,045,006 V574A probably benign Het
Filip1 T C 9: 79,819,930 E469G probably damaging Het
Fmo1 A T 1: 162,833,855 D286E probably damaging Het
Fmo4 A T 1: 162,799,047 I310N possibly damaging Het
Focad A G 4: 88,342,212 N902D unknown Het
Focad A G 4: 88,397,179 S1525G probably benign Het
Fras1 T C 5: 96,667,437 W1338R probably benign Het
Fry A G 5: 150,400,924 I1151V probably null Het
Gm10076 T G 14: 105,681,870 noncoding transcript Het
Gm13088 G A 4: 143,654,142 T437I probably damaging Het
Gm5698 T G 1: 30,977,961 D3A probably damaging Het
Gm8394 A G 10: 85,313,731 noncoding transcript Het
Gngt2 C T 11: 95,845,146 probably benign Het
Gsdma T C 11: 98,671,367 probably null Het
Gtf2h3 A T 5: 124,602,199 probably benign Het
Hkdc1 T C 10: 62,417,898 T35A probably benign Het
Irs1 T C 1: 82,288,459 S679G probably benign Het
Itpr1 T A 6: 108,493,755 C2214S probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 74 probably benign Het
Kcnk16 A G 14: 20,265,279 V72A probably damaging Het
Matr3 T A 18: 35,588,325 probably benign Het
Med13l T G 5: 118,728,833 F651V probably benign Het
Mfsd11 T C 11: 116,873,914 V388A probably benign Het
Mki67 C T 7: 135,698,065 V1747I possibly damaging Het
Mms22l T C 4: 24,535,936 probably benign Het
Msh5 A G 17: 35,044,390 I154T probably benign Het
Myo5b G T 18: 74,733,925 L1382F probably damaging Het
Ncbp2 T C 16: 31,956,951 Y138H probably damaging Het
Ndufv1 C A 19: 4,008,347 R359L probably benign Het
Ntrk3 A C 7: 78,516,723 probably null Het
Olfr1234 A G 2: 89,363,009 V140A probably benign Het
Olfr376 T A 11: 73,375,601 V287E probably damaging Het
Olfr870 T A 9: 20,171,409 H54L possibly damaging Het
P4ha1 A G 10: 59,371,037 E523G probably damaging Het
Per3 T A 4: 151,018,885 Y530F probably damaging Het
Pes1 C A 11: 3,969,524 L66I probably damaging Het
Pigr G A 1: 130,846,662 probably benign Het
Pkd1l1 A T 11: 8,836,197 probably benign Het
Plch1 T A 3: 63,744,535 K378N probably damaging Het
Plxnb1 T C 9: 109,102,708 probably null Het
Prkdc A G 16: 15,654,817 probably null Het
Prrc1 G T 18: 57,381,646 D312Y probably damaging Het
Rab3gap2 T A 1: 185,283,542 probably null Het
Rgs3 A G 4: 62,702,147 I537V probably damaging Het
Rhobtb2 T G 14: 69,796,444 D444A probably damaging Het
Rnf40 T C 7: 127,591,784 S314P probably damaging Het
Rngtt T A 4: 33,500,302 C565* probably null Het
Samd3 A G 10: 26,263,986 probably benign Het
Sec61a2 A G 2: 5,873,736 probably benign Het
Serpina3m G A 12: 104,389,322 A83T probably damaging Het
Serpinb13 A T 1: 106,999,026 I251L possibly damaging Het
Sez6 C T 11: 77,972,932 T439I probably damaging Het
Shc1 G A 3: 89,423,542 G91S probably damaging Het
Slc26a2 A G 18: 61,198,578 C594R possibly damaging Het
Specc1l C T 10: 75,245,604 S278F probably damaging Het
Spg11 C T 2: 122,060,207 V2044M probably damaging Het
Stx18 T A 5: 38,128,039 probably null Het
Suclg2 T C 6: 95,589,094 probably benign Het
Tlr4 A T 4: 66,839,444 H158L probably damaging Het
Tmem131 A G 1: 36,812,271 V966A possibly damaging Het
Tram1l1 T A 3: 124,321,986 I265N probably damaging Het
Trim58 T A 11: 58,640,667 F67Y possibly damaging Het
Ttc19 A G 11: 62,281,824 Q74R probably benign Het
Usp7 T C 16: 8,698,469 S649G probably benign Het
Vmn2r16 A G 5: 109,339,258 Y115C possibly damaging Het
Zfp444 T C 7: 6,189,555 C191R probably damaging Het
Zfp451 A G 1: 33,782,193 F151L probably damaging Het
Zfp451 G A 1: 33,783,856 P99S probably benign Het
Zfp729b A T 13: 67,592,233 C648S probably damaging Het
Zfp799 A G 17: 32,821,803 Y58H probably damaging Het
Zfp804b A G 5: 6,769,748 V1069A probably benign Het
Zfp938 C T 10: 82,225,547 G413D probably damaging Het
Other mutations in Lipa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Lipa APN 19 34494035 missense probably damaging 1.00
IGL02517:Lipa APN 19 34494122 missense possibly damaging 0.47
IGL02869:Lipa APN 19 34493997 missense probably benign 0.01
IGL02869:Lipa APN 19 34493971 utr 3 prime probably benign
buckboard UTSW 19 34524746 missense probably benign 0.04
Pashtun UTSW 19 34510928 missense probably damaging 1.00
suri UTSW 19 34501634 nonsense probably null
R0071:Lipa UTSW 19 34495082 missense probably damaging 1.00
R0244:Lipa UTSW 19 34501541 missense probably damaging 1.00
R1871:Lipa UTSW 19 34510928 missense probably damaging 1.00
R2189:Lipa UTSW 19 34524799 missense probably benign 0.13
R2270:Lipa UTSW 19 34510890 nonsense probably null
R2271:Lipa UTSW 19 34510890 nonsense probably null
R2272:Lipa UTSW 19 34510890 nonsense probably null
R4737:Lipa UTSW 19 34501634 nonsense probably null
R5713:Lipa UTSW 19 34523432 missense probably benign 0.00
R6381:Lipa UTSW 19 34524746 missense probably benign 0.04
R8338:Lipa UTSW 19 34494077 missense probably benign 0.01
RF012:Lipa UTSW 19 34509098 missense probably damaging 1.00
X0067:Lipa UTSW 19 34509020 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2014-07-14