Incidental Mutation 'R1930:Cep152'
ID215241
Institutional Source Beutler Lab
Gene Symbol Cep152
Ensembl Gene ENSMUSG00000068394
Gene Namecentrosomal protein 152
Synonyms
MMRRC Submission 039948-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1930 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125563088-125625113 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 125618371 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000087208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089776]
Predicted Effect probably null
Transcript: ENSMUST00000089776
SMART Domains Protein: ENSMUSP00000087208
Gene: ENSMUSG00000068394

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
coiled coil region 228 481 N/A INTRINSIC
low complexity region 582 593 N/A INTRINSIC
coiled coil region 602 651 N/A INTRINSIC
coiled coil region 692 770 N/A INTRINSIC
low complexity region 780 793 N/A INTRINSIC
coiled coil region 835 868 N/A INTRINSIC
coiled coil region 954 1038 N/A INTRINSIC
coiled coil region 1205 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved with centrosome function. Mutations in this gene have been associated with primary microcephaly (MCPH4). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Embryos homozygous for a null allele exhibit reduced numbers of centrosomes and cilia, increased apoptosis, and midgestation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2410002F23Rik T A 7: 44,251,116 D148E probably damaging Het
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
4933430I17Rik A T 4: 62,532,282 D31V possibly damaging Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Ago2 A T 15: 73,119,355 I578N probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Chrnb1 A G 11: 69,792,737 L261P possibly damaging Het
Cntn3 C T 6: 102,242,053 W535* probably null Het
Col4a4 A C 1: 82,466,600 probably null Het
Daam2 A T 17: 49,462,213 probably null Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Glt8d2 G T 10: 82,664,642 S91R probably benign Het
H2-Oa A T 17: 34,093,899 H50L possibly damaging Het
Hsd17b2 T C 8: 117,758,904 Y369H possibly damaging Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Ice1 A T 13: 70,605,083 S961R probably benign Het
Ift20 G A 11: 78,540,004 V58I possibly damaging Het
Ippk T A 13: 49,450,018 F367I probably damaging Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Krtcap2 T A 3: 89,247,076 N35K probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Magi3 A T 3: 104,089,604 D208E probably damaging Het
Mc2r T A 18: 68,407,782 T147S probably benign Het
Mfsd4b1 C A 10: 40,006,074 A72S probably benign Het
Msln A T 17: 25,751,922 N150K probably damaging Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfr1264 G A 2: 90,021,161 R302C probably benign Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Pcnx2 C A 8: 125,887,714 V333L probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pkhd1l1 A G 15: 44,503,337 D737G possibly damaging Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Scgb2b20 T C 7: 33,366,196 probably null Het
Sdr16c6 A G 4: 4,058,809 V259A probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc51b T A 9: 65,415,196 E21V probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
Specc1l A G 10: 75,309,824 D1101G probably damaging Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tdg T A 10: 82,641,544 L35Q probably damaging Het
Tekt2 T C 4: 126,322,817 probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Tspyl3 A G 2: 153,224,797 F174L probably damaging Het
Ttn C T 2: 76,722,849 D31099N probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp60 T A 7: 27,736,957 M1K probably null Het
Other mutations in Cep152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cep152 APN 2 125563888 missense probably benign 0.01
IGL00561:Cep152 APN 2 125563723 nonsense probably null
IGL01082:Cep152 APN 2 125569545 splice site probably benign
IGL01420:Cep152 APN 2 125563652 missense possibly damaging 0.49
IGL01832:Cep152 APN 2 125618494 nonsense probably null
IGL02106:Cep152 APN 2 125602936 splice site probably null
IGL02124:Cep152 APN 2 125563461 missense probably benign 0.23
IGL02349:Cep152 APN 2 125594956 missense probably damaging 0.99
IGL02541:Cep152 APN 2 125605354 missense probably damaging 1.00
IGL02659:Cep152 APN 2 125579549 missense probably damaging 0.96
IGL02711:Cep152 APN 2 125563942 missense possibly damaging 0.93
IGL02737:Cep152 APN 2 125586474 missense possibly damaging 0.71
IGL03060:Cep152 APN 2 125619987 splice site probably benign
IGL03095:Cep152 APN 2 125618451 missense probably benign 0.00
IGL03186:Cep152 APN 2 125563975 missense probably benign
IGL03306:Cep152 APN 2 125605408 missense possibly damaging 0.90
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0079:Cep152 UTSW 2 125618453 missense possibly damaging 0.92
R0244:Cep152 UTSW 2 125564214 missense probably benign 0.00
R0390:Cep152 UTSW 2 125576869 splice site probably benign
R0462:Cep152 UTSW 2 125583934 missense possibly damaging 0.64
R0480:Cep152 UTSW 2 125581719 missense possibly damaging 0.95
R0595:Cep152 UTSW 2 125595063 missense probably damaging 0.99
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R1634:Cep152 UTSW 2 125583889 missense probably benign 0.00
R1664:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1693:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1887:Cep152 UTSW 2 125620305 missense probably benign 0.00
R2178:Cep152 UTSW 2 125580034 splice site probably null
R2225:Cep152 UTSW 2 125581784 missense probably damaging 1.00
R2324:Cep152 UTSW 2 125563462 missense probably benign 0.38
R2416:Cep152 UTSW 2 125564172 nonsense probably null
R2845:Cep152 UTSW 2 125587974 missense probably damaging 1.00
R3753:Cep152 UTSW 2 125625052 unclassified probably benign
R4212:Cep152 UTSW 2 125620001 missense probably benign 0.00
R4304:Cep152 UTSW 2 125563723 nonsense probably null
R4371:Cep152 UTSW 2 125613047 missense probably damaging 1.00
R4399:Cep152 UTSW 2 125587980 missense possibly damaging 0.63
R4536:Cep152 UTSW 2 125602947 splice site probably null
R4713:Cep152 UTSW 2 125587948 missense possibly damaging 0.79
R4777:Cep152 UTSW 2 125564095 missense probably benign 0.29
R4779:Cep152 UTSW 2 125568892 missense possibly damaging 0.52
R4785:Cep152 UTSW 2 125586329 critical splice donor site probably null
R4816:Cep152 UTSW 2 125563754 missense probably damaging 1.00
R4847:Cep152 UTSW 2 125618474 missense possibly damaging 0.62
R4898:Cep152 UTSW 2 125586381 missense probably benign 0.03
R4934:Cep152 UTSW 2 125611096 missense possibly damaging 0.52
R4997:Cep152 UTSW 2 125586351 missense probably benign 0.00
R5068:Cep152 UTSW 2 125571816 missense probably benign 0.25
R5183:Cep152 UTSW 2 125566638 missense probably damaging 1.00
R5198:Cep152 UTSW 2 125587624 missense probably benign
R5261:Cep152 UTSW 2 125564205 missense probably benign 0.06
R5272:Cep152 UTSW 2 125611030 missense probably benign 0.27
R5284:Cep152 UTSW 2 125580021 missense probably damaging 1.00
R6029:Cep152 UTSW 2 125563632 missense probably benign 0.44
R6155:Cep152 UTSW 2 125581700 missense probably benign
R6239:Cep152 UTSW 2 125579412 missense probably benign 0.40
R6590:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6690:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6754:Cep152 UTSW 2 125587668 missense probably damaging 0.99
R6798:Cep152 UTSW 2 125566527 splice site probably null
R6816:Cep152 UTSW 2 125595027 missense probably damaging 1.00
R6977:Cep152 UTSW 2 125568822 critical splice donor site probably null
R7125:Cep152 UTSW 2 125566673 nonsense probably null
R7146:Cep152 UTSW 2 125614405 missense probably benign 0.06
R7588:Cep152 UTSW 2 125569626 missense probably damaging 1.00
R7852:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7883:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R7935:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7966:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R8047:Cep152 UTSW 2 125564327 missense not run
X0009:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0010:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0011:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0014:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0017:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0021:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0022:Cep152 UTSW 2 125620063 missense probably benign 0.07
X0023:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0028:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0033:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0064:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0067:Cep152 UTSW 2 125614386 missense probably damaging 1.00
Z1176:Cep152 UTSW 2 125583971 missense not run
Z1177:Cep152 UTSW 2 125614324 missense not run
Z1177:Cep152 UTSW 2 125619704 missense not run
Predicted Primers PCR Primer
(F):5'- ACTCACACGGACCTTGAGTG -3'
(R):5'- TTTGGTTTATCTCGAGGACCC -3'

Sequencing Primer
(F):5'- TCAAGCTGACCCTAACTGGTG -3'
(R):5'- GTTTATCTCGAGGACCCAGCTG -3'
Posted On2014-07-14