Incidental Mutation 'R0128:Flnb'
ID 21525
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Name filamin, beta
Synonyms
MMRRC Submission 038413-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0128 (G1)
Quality Score 185
Status Validated
Chromosome 14
Chromosomal Location 14518185-14651816 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7901951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 938 (V938A)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
AlphaFold Q80X90
Predicted Effect probably damaging
Transcript: ENSMUST00000052678
AA Change: V938A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: V938A

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.3388 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,552,602 (GRCm39) probably benign Het
Abcd4 T G 12: 84,659,126 (GRCm39) Q210P possibly damaging Het
Ablim2 G A 5: 35,966,520 (GRCm39) probably benign Het
Acte1 G T 7: 143,445,492 (GRCm39) G178C probably damaging Het
Actl6b A G 5: 137,553,327 (GRCm39) N113S probably benign Het
Actn3 A T 19: 4,921,643 (GRCm39) V179E probably damaging Het
Aff4 C A 11: 53,306,293 (GRCm39) T1145N probably damaging Het
Ankrd42 G A 7: 92,241,067 (GRCm39) Q431* probably null Het
Anxa9 A G 3: 95,209,733 (GRCm39) S129P probably benign Het
Arfgef2 T G 2: 166,677,639 (GRCm39) I88S probably damaging Het
Asap3 C A 4: 135,961,915 (GRCm39) N285K probably damaging Het
Atp6v0a2 A G 5: 124,790,248 (GRCm39) N477S probably damaging Het
Atp7b C T 8: 22,518,188 (GRCm39) E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 (GRCm39) probably null Het
C87436 G A 6: 86,446,809 (GRCm39) G533D probably damaging Het
Ccdc138 T A 10: 58,364,182 (GRCm39) I314N probably damaging Het
Ccs A G 19: 4,875,654 (GRCm39) F237S probably damaging Het
Ccz1 T G 5: 143,946,112 (GRCm39) probably benign Het
Cdcp2 C T 4: 106,963,904 (GRCm39) probably benign Het
Chd1 A G 17: 17,613,829 (GRCm39) N531S probably damaging Het
Clptm1 A T 7: 19,368,932 (GRCm39) F476I probably damaging Het
Colec12 C T 18: 9,858,921 (GRCm39) P568L unknown Het
Cped1 T A 6: 22,121,038 (GRCm39) Y373N probably benign Het
Cr2 A T 1: 194,848,539 (GRCm39) V328D probably damaging Het
D630045J12Rik A T 6: 38,126,706 (GRCm39) probably benign Het
Dcdc2a A T 13: 25,371,655 (GRCm39) probably benign Het
Dlg1 G T 16: 31,676,883 (GRCm39) probably null Het
Epb41l5 A C 1: 119,477,632 (GRCm39) V705G possibly damaging Het
Ergic3 C A 2: 155,853,060 (GRCm39) R43S possibly damaging Het
Frmd4a T C 2: 4,608,903 (GRCm39) Y928H probably damaging Het
Fyn C T 10: 39,387,978 (GRCm39) T78M probably benign Het
Gdap2 A G 3: 100,109,311 (GRCm39) T443A probably damaging Het
Ghrl A T 6: 113,694,129 (GRCm39) probably benign Het
Gm4787 T A 12: 81,424,521 (GRCm39) K546* probably null Het
Gm6576 C G 15: 27,026,086 (GRCm39) noncoding transcript Het
Got1 C T 19: 43,512,816 (GRCm39) D27N probably benign Het
Gucy2c C T 6: 136,681,247 (GRCm39) V946I probably damaging Het
Hectd4 T C 5: 121,487,306 (GRCm39) Y3434H possibly damaging Het
Hp1bp3 C T 4: 137,964,520 (GRCm39) S348F probably damaging Het
Itpr1 A G 6: 108,448,170 (GRCm39) probably benign Het
Kctd1 G A 18: 15,107,237 (GRCm39) P743S probably benign Het
Klhl23 T C 2: 69,664,310 (GRCm39) V553A probably damaging Het
Krt24 T C 11: 99,171,093 (GRCm39) D495G probably damaging Het
L3hypdh C T 12: 72,123,917 (GRCm39) probably null Het
Lipo3 C T 19: 33,534,506 (GRCm39) probably null Het
Lman2l G T 1: 36,463,945 (GRCm39) S171* probably null Het
Lrp1b T C 2: 41,401,520 (GRCm39) D378G probably damaging Het
Map3k4 T A 17: 12,466,950 (GRCm39) D1104V probably damaging Het
Mpeg1 T C 19: 12,438,587 (GRCm39) V15A probably benign Het
Narf C T 11: 121,141,662 (GRCm39) R356C probably damaging Het
Nebl T A 2: 17,397,834 (GRCm39) Q487H possibly damaging Het
Olfm5 G A 7: 103,810,133 (GRCm39) A76V probably benign Het
Or1j11 T A 2: 36,312,299 (GRCm39) D296E probably benign Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or52p1 A T 7: 104,267,788 (GRCm39) I301F probably damaging Het
Or5ak22 T A 2: 85,230,305 (GRCm39) S191C probably damaging Het
Or8k40 T C 2: 86,584,231 (GRCm39) M284V probably benign Het
Palb2 A T 7: 121,727,389 (GRCm39) Y160* probably null Het
Pasd1 T C X: 70,983,161 (GRCm39) C378R possibly damaging Het
Paxip1 C T 5: 27,949,183 (GRCm39) probably benign Het
Pclo A G 5: 14,729,811 (GRCm39) probably benign Het
Pdcd11 G A 19: 47,108,301 (GRCm39) V1223I probably benign Het
Pde6c T C 19: 38,157,813 (GRCm39) probably benign Het
Prr12 A G 7: 44,699,463 (GRCm39) probably benign Het
Prss39 T A 1: 34,541,281 (GRCm39) probably benign Het
Samd5 A G 10: 9,550,683 (GRCm39) W9R probably damaging Het
Sfr1 A G 19: 47,723,457 (GRCm39) *320W probably null Het
Sft2d1rt A G 11: 45,943,120 (GRCm39) M1T probably null Het
Sh3bp4 A G 1: 89,073,036 (GRCm39) N628S possibly damaging Het
Sim1 A T 10: 50,784,057 (GRCm39) I104F probably damaging Het
Slc1a3 T C 15: 8,665,693 (GRCm39) M519V probably benign Het
Smcp T A 3: 92,491,827 (GRCm39) T7S unknown Het
Sp4 A G 12: 118,264,551 (GRCm39) probably benign Het
Spag9 T A 11: 93,984,365 (GRCm39) I327N probably damaging Het
Thbs4 G T 13: 92,890,918 (GRCm39) H850N probably benign Het
Ubap2l A T 3: 89,928,680 (GRCm39) S478T possibly damaging Het
Unc79 A G 12: 103,054,693 (GRCm39) probably benign Het
Vmn2r85 A G 10: 130,255,054 (GRCm39) probably benign Het
Wrap73 A G 4: 154,226,957 (GRCm39) D19G possibly damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7,917,390 (GRCm38) splice site probably benign
IGL01063:Flnb APN 14 7,926,518 (GRCm38) splice site probably benign
IGL01135:Flnb APN 14 7,909,736 (GRCm38) missense probably benign
IGL01139:Flnb APN 14 7,945,989 (GRCm38) missense probably damaging 1.00
IGL01364:Flnb APN 14 7,934,562 (GRCm38) critical splice acceptor site probably null
IGL01417:Flnb APN 14 7,905,513 (GRCm38) missense probably damaging 0.99
IGL01505:Flnb APN 14 7,902,003 (GRCm38) critical splice donor site probably null
IGL01560:Flnb APN 14 7,893,829 (GRCm38) missense probably benign 0.07
IGL01621:Flnb APN 14 7,950,470 (GRCm38) missense probably damaging 1.00
IGL01656:Flnb APN 14 7,902,010 (GRCm38) splice site probably benign
IGL01889:Flnb APN 14 7,935,967 (GRCm38) missense possibly damaging 0.85
IGL01987:Flnb APN 14 7,922,748 (GRCm38) critical splice donor site probably null
IGL02322:Flnb APN 14 7,894,676 (GRCm38) missense probably damaging 1.00
IGL02496:Flnb APN 14 7,930,919 (GRCm38) splice site probably benign
IGL02752:Flnb APN 14 7,917,338 (GRCm38) missense probably benign
IGL03001:Flnb APN 14 7,934,680 (GRCm38) missense probably damaging 0.99
IGL03076:Flnb APN 14 7,901,988 (GRCm38) missense probably benign 0.01
IGL03085:Flnb APN 14 7,882,211 (GRCm38) missense probably benign
IGL03170:Flnb APN 14 7,818,261 (GRCm38) missense possibly damaging 0.90
IGL03373:Flnb APN 14 7,890,867 (GRCm38) critical splice donor site probably null
Boomerang UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
Queensland UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
Rhodelinda UTSW 14 7,887,682 (GRCm38) splice site probably benign
saul UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
Xerxes UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0068:Flnb UTSW 14 7,915,290 (GRCm38) missense possibly damaging 0.49
R0084:Flnb UTSW 14 7,935,979 (GRCm38) missense probably benign
R0130:Flnb UTSW 14 7,901,951 (GRCm38) missense probably damaging 0.99
R0148:Flnb UTSW 14 7,939,077 (GRCm38) missense probably benign 0.01
R0166:Flnb UTSW 14 7,896,115 (GRCm38) missense probably damaging 1.00
R0376:Flnb UTSW 14 7,946,014 (GRCm38) critical splice donor site probably null
R0547:Flnb UTSW 14 7,912,943 (GRCm38) splice site probably null
R0612:Flnb UTSW 14 7,887,682 (GRCm38) splice site probably benign
R0656:Flnb UTSW 14 7,927,352 (GRCm38) missense probably damaging 1.00
R0691:Flnb UTSW 14 7,890,810 (GRCm38) missense probably benign 0.16
R1241:Flnb UTSW 14 7,896,503 (GRCm38) missense probably benign 0.06
R1572:Flnb UTSW 14 7,883,908 (GRCm38) missense probably damaging 0.97
R1682:Flnb UTSW 14 7,913,121 (GRCm38) missense probably benign 0.04
R1807:Flnb UTSW 14 7,934,645 (GRCm38) missense probably benign 0.26
R1848:Flnb UTSW 14 7,892,113 (GRCm38) missense probably damaging 1.00
R1959:Flnb UTSW 14 7,884,735 (GRCm38) nonsense probably null
R2078:Flnb UTSW 14 7,927,466 (GRCm38) missense probably damaging 1.00
R2132:Flnb UTSW 14 7,873,376 (GRCm38) missense probably benign 0.04
R2209:Flnb UTSW 14 7,905,507 (GRCm38) nonsense probably null
R2212:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2213:Flnb UTSW 14 7,881,652 (GRCm38) small deletion probably benign
R2363:Flnb UTSW 14 7,945,950 (GRCm38) missense possibly damaging 0.95
R2415:Flnb UTSW 14 7,929,932 (GRCm38) missense probably benign 0.07
R2983:Flnb UTSW 14 7,882,250 (GRCm38) missense probably damaging 1.00
R3001:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3002:Flnb UTSW 14 7,907,162 (GRCm38) missense probably benign 0.22
R3436:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3437:Flnb UTSW 14 7,942,057 (GRCm38) missense probably damaging 0.97
R3778:Flnb UTSW 14 7,915,353 (GRCm38) missense probably benign 0.06
R3783:Flnb UTSW 14 7,889,236 (GRCm38) missense probably benign 0.04
R4162:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4163:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4164:Flnb UTSW 14 7,915,374 (GRCm38) missense possibly damaging 0.81
R4356:Flnb UTSW 14 7,922,700 (GRCm38) missense probably benign
R4369:Flnb UTSW 14 7,942,216 (GRCm38) missense probably benign
R4783:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4785:Flnb UTSW 14 7,905,701 (GRCm38) missense probably benign 0.12
R4790:Flnb UTSW 14 7,905,661 (GRCm38) missense probably benign 0.34
R4828:Flnb UTSW 14 7,919,238 (GRCm38) missense probably benign 0.13
R4882:Flnb UTSW 14 7,929,936 (GRCm38) missense possibly damaging 0.56
R5002:Flnb UTSW 14 7,945,882 (GRCm38) missense probably damaging 1.00
R5058:Flnb UTSW 14 7,924,262 (GRCm38) nonsense probably null
R5184:Flnb UTSW 14 7,901,945 (GRCm38) missense probably damaging 1.00
R5186:Flnb UTSW 14 7,909,748 (GRCm38) missense probably damaging 1.00
R5395:Flnb UTSW 14 7,883,881 (GRCm38) missense probably benign 0.02
R5421:Flnb UTSW 14 7,926,494 (GRCm38) missense probably damaging 1.00
R5667:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5671:Flnb UTSW 14 7,890,843 (GRCm38) missense probably benign 0.00
R5714:Flnb UTSW 14 7,929,073 (GRCm38) missense probably damaging 1.00
R5860:Flnb UTSW 14 7,931,135 (GRCm38) missense probably damaging 1.00
R5892:Flnb UTSW 14 7,907,183 (GRCm38) missense probably damaging 1.00
R5924:Flnb UTSW 14 7,890,765 (GRCm38) missense probably benign 0.00
R6131:Flnb UTSW 14 7,894,635 (GRCm38) missense possibly damaging 0.79
R6244:Flnb UTSW 14 7,892,092 (GRCm38) missense probably damaging 1.00
R6489:Flnb UTSW 14 7,867,551 (GRCm38) missense probably damaging 1.00
R6582:Flnb UTSW 14 7,892,275 (GRCm38) critical splice donor site probably null
R6586:Flnb UTSW 14 7,929,138 (GRCm38) missense possibly damaging 0.93
R6611:Flnb UTSW 14 7,915,318 (GRCm38) missense probably damaging 1.00
R6626:Flnb UTSW 14 7,929,012 (GRCm38) missense probably damaging 1.00
R6700:Flnb UTSW 14 7,892,189 (GRCm38) missense probably damaging 0.99
R6738:Flnb UTSW 14 7,904,536 (GRCm38) missense probably benign 0.01
R6864:Flnb UTSW 14 7,905,640 (GRCm38) missense possibly damaging 0.84
R6916:Flnb UTSW 14 7,907,171 (GRCm38) missense probably damaging 0.99
R7117:Flnb UTSW 14 7,894,214 (GRCm38) missense probably benign 0.02
R7164:Flnb UTSW 14 7,915,944 (GRCm38) splice site probably null
R7328:Flnb UTSW 14 7,894,660 (GRCm38) nonsense probably null
R7328:Flnb UTSW 14 7,883,788 (GRCm38) missense possibly damaging 0.95
R7687:Flnb UTSW 14 7,924,224 (GRCm38) missense probably damaging 1.00
R7716:Flnb UTSW 14 7,917,274 (GRCm38) missense possibly damaging 0.64
R7763:Flnb UTSW 14 7,926,478 (GRCm38) missense probably benign 0.00
R7821:Flnb UTSW 14 7,939,113 (GRCm38) missense probably benign 0.00
R7921:Flnb UTSW 14 7,933,800 (GRCm38) missense possibly damaging 0.57
R8008:Flnb UTSW 14 7,892,155 (GRCm38) missense probably damaging 1.00
R8075:Flnb UTSW 14 7,913,048 (GRCm38) missense probably benign 0.00
R8084:Flnb UTSW 14 7,907,243 (GRCm38) missense probably benign 0.00
R8259:Flnb UTSW 14 7,889,183 (GRCm38) missense probably damaging 0.99
R8441:Flnb UTSW 14 7,896,488 (GRCm38) missense probably benign 0.15
R8493:Flnb UTSW 14 7,869,822 (GRCm38) missense probably damaging 0.97
R8508:Flnb UTSW 14 7,950,394 (GRCm38) missense probably damaging 0.98
R8531:Flnb UTSW 14 7,929,939 (GRCm38) missense probably damaging 1.00
R8812:Flnb UTSW 14 7,887,624 (GRCm38) missense probably benign 0.06
R8814:Flnb UTSW 14 7,927,409 (GRCm38) missense probably damaging 1.00
R8825:Flnb UTSW 14 7,887,566 (GRCm38) missense probably damaging 1.00
R8868:Flnb UTSW 14 7,908,671 (GRCm38) missense probably benign 0.02
R8955:Flnb UTSW 14 7,904,688 (GRCm38) nonsense probably null
R8955:Flnb UTSW 14 7,892,874 (GRCm38) missense probably damaging 1.00
R8976:Flnb UTSW 14 7,901,882 (GRCm38) critical splice acceptor site probably null
R9055:Flnb UTSW 14 7,908,553 (GRCm38) missense probably benign 0.00
R9148:Flnb UTSW 14 7,817,996 (GRCm38) start gained probably benign
R9179:Flnb UTSW 14 7,887,541 (GRCm38) nonsense probably null
R9180:Flnb UTSW 14 7,818,219 (GRCm38) missense probably damaging 1.00
R9189:Flnb UTSW 14 7,892,976 (GRCm38) missense possibly damaging 0.90
R9286:Flnb UTSW 14 7,873,414 (GRCm38) missense probably damaging 0.98
R9288:Flnb UTSW 14 7,904,498 (GRCm38) missense probably benign 0.43
R9354:Flnb UTSW 14 7,818,411 (GRCm38) missense probably benign 0.13
R9484:Flnb UTSW 14 7,929,004 (GRCm38) missense probably benign 0.06
R9505:Flnb UTSW 14 7,904,665 (GRCm38) missense probably benign
R9525:Flnb UTSW 14 7,905,481 (GRCm38) missense probably damaging 1.00
R9621:Flnb UTSW 14 7,926,421 (GRCm38) missense probably damaging 0.99
R9630:Flnb UTSW 14 7,926,438 (GRCm38) nonsense probably null
R9739:Flnb UTSW 14 7,935,954 (GRCm38) nonsense probably null
R9760:Flnb UTSW 14 7,929,846 (GRCm38) missense probably damaging 0.98
X0066:Flnb UTSW 14 7,908,636 (GRCm38) missense probably damaging 1.00
Z1088:Flnb UTSW 14 7,905,871 (GRCm38) missense probably benign 0.04
Z1176:Flnb UTSW 14 7,942,066 (GRCm38) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GTTTCCTGAAGCCAGTAAGAGGCATAC -3'
(R):5'- AACATCGGCAGTCTCACAGAGC -3'

Sequencing Primer
(F):5'- ggctccctgaaagatatgagac -3'
(R):5'- ACTTCCATGAGTCTAAGTGACC -3'
Posted On 2013-04-11