Incidental Mutation 'R1930:Tnrc18'
ID215263
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Nametrinucleotide repeat containing 18
SynonymsZfp469, EG381742
MMRRC Submission 039948-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R1930 (G1)
Quality Score139
Status Not validated
Chromosome5
Chromosomal Location142724661-142817662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142776324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 515 (N515K)
Ref Sequence ENSEMBL: ENSMUSP00000117651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
Predicted Effect unknown
Transcript: ENSMUST00000036253
AA Change: N698K
SMART Domains Protein: ENSMUSP00000040287
Gene: ENSMUSG00000039477
AA Change: N698K

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
low complexity region 820 859 N/A INTRINSIC
low complexity region 915 929 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 979 992 N/A INTRINSIC
low complexity region 1092 1111 N/A INTRINSIC
low complexity region 1268 1288 N/A INTRINSIC
coiled coil region 1410 1442 N/A INTRINSIC
low complexity region 1476 1492 N/A INTRINSIC
low complexity region 1580 1592 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1734 1751 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151477
AA Change: N698K
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: N698K

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: N515K
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: N515K

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2410002F23Rik T A 7: 44,251,116 D148E probably damaging Het
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
4933430I17Rik A T 4: 62,532,282 D31V possibly damaging Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Ago2 A T 15: 73,119,355 I578N probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Cep152 A T 2: 125,618,371 probably null Het
Chrnb1 A G 11: 69,792,737 L261P possibly damaging Het
Cntn3 C T 6: 102,242,053 W535* probably null Het
Col4a4 A C 1: 82,466,600 probably null Het
Daam2 A T 17: 49,462,213 probably null Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Glt8d2 G T 10: 82,664,642 S91R probably benign Het
H2-Oa A T 17: 34,093,899 H50L possibly damaging Het
Hsd17b2 T C 8: 117,758,904 Y369H possibly damaging Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Ice1 A T 13: 70,605,083 S961R probably benign Het
Ift20 G A 11: 78,540,004 V58I possibly damaging Het
Ippk T A 13: 49,450,018 F367I probably damaging Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Krtcap2 T A 3: 89,247,076 N35K probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Magi3 A T 3: 104,089,604 D208E probably damaging Het
Mc2r T A 18: 68,407,782 T147S probably benign Het
Mfsd4b1 C A 10: 40,006,074 A72S probably benign Het
Msln A T 17: 25,751,922 N150K probably damaging Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfr1264 G A 2: 90,021,161 R302C probably benign Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Pcnx2 C A 8: 125,887,714 V333L probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pkhd1l1 A G 15: 44,503,337 D737G possibly damaging Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Scgb2b20 T C 7: 33,366,196 probably null Het
Sdr16c6 A G 4: 4,058,809 V259A probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc51b T A 9: 65,415,196 E21V probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
Specc1l A G 10: 75,309,824 D1101G probably damaging Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tdg T A 10: 82,641,544 L35Q probably damaging Het
Tekt2 T C 4: 126,322,817 probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Tspyl3 A G 2: 153,224,797 F174L probably damaging Het
Ttn C T 2: 76,722,849 D31099N probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp60 T A 7: 27,736,957 M1K probably null Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
R8322:Tnrc18 UTSW 5 142726012 missense probably damaging 1.00
R8379:Tnrc18 UTSW 5 142788402 missense
RF022:Tnrc18 UTSW 5 142773630 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer
(F):5'- TGGGGACACATACGTCACTC -3'
(R):5'- AGACCCTTAGCTGTTCCCAG -3'

Sequencing Primer
(F):5'- GAAAGACTAACTTGGTCCCAGTCTTC -3'
(R):5'- ACCAGCTGTTCCCATACT -3'
Posted On2014-07-14