Incidental Mutation 'R0128:Map3k4'
ID21528
Institutional Source Beutler Lab
Gene Symbol Map3k4
Ensembl Gene ENSMUSG00000014426
Gene Namemitogen-activated protein kinase kinase kinase 4
SynonymsD17Rp17, D17Rp17e, RP17, MAPKKK4, Mekk4, MTK1, Tas
MMRRC Submission 038413-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.927) question?
Stock #R0128 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location12227621-12318660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12248063 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1104 (D1104V)
Ref Sequence ENSEMBL: ENSMUSP00000086459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089058]
Predicted Effect probably damaging
Transcript: ENSMUST00000089058
AA Change: D1104V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: D1104V

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 215 235 N/A INTRINSIC
low complexity region 432 462 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
S_TKc 1332 1590 1.41e-91 SMART
Meta Mutation Damage Score 0.1357 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.6%
  • 10x: 93.0%
  • 20x: 79.3%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A G 6: 128,575,639 probably benign Het
Abcd4 T G 12: 84,612,352 Q210P possibly damaging Het
Ablim2 G A 5: 35,809,176 probably benign Het
Actl6b A G 5: 137,555,065 N113S probably benign Het
Actn3 A T 19: 4,871,615 V179E probably damaging Het
Aff4 C A 11: 53,415,466 T1145N probably damaging Het
Ankrd42 G A 7: 92,591,859 Q431* probably null Het
Anxa9 A G 3: 95,302,422 S129P probably benign Het
Arfgef2 T G 2: 166,835,719 I88S probably damaging Het
Asap3 C A 4: 136,234,604 N285K probably damaging Het
Atp6v0a2 A G 5: 124,713,184 N477S probably damaging Het
Atp7b C T 8: 22,028,172 E205K possibly damaging Het
Atp8b5 T A 4: 43,369,715 probably null Het
C87436 G A 6: 86,469,827 G533D probably damaging Het
Ccdc138 T A 10: 58,528,360 I314N probably damaging Het
Ccs A G 19: 4,825,626 F237S probably damaging Het
Ccz1 T G 5: 144,009,294 probably benign Het
Cdcp2 C T 4: 107,106,707 probably benign Het
Chd1 A G 17: 17,393,567 N531S probably damaging Het
Clptm1 A T 7: 19,635,007 F476I probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cped1 T A 6: 22,121,039 Y373N probably benign Het
Cr2 A T 1: 195,166,231 V328D probably damaging Het
D630045J12Rik A T 6: 38,149,771 probably benign Het
Dcdc2a A T 13: 25,187,672 probably benign Het
Dlg1 G T 16: 31,858,065 probably null Het
Epb41l5 A C 1: 119,549,902 V705G possibly damaging Het
Ergic3 C A 2: 156,011,140 R43S possibly damaging Het
Flnb T C 14: 7,901,951 V938A probably damaging Het
Frmd4a T C 2: 4,604,092 Y928H probably damaging Het
Fyn C T 10: 39,511,982 T78M probably benign Het
Gdap2 A G 3: 100,201,995 T443A probably damaging Het
Ghrl A T 6: 113,717,168 probably benign Het
Gm1141 T C X: 71,939,555 C378R possibly damaging Het
Gm12166 A G 11: 46,052,293 M1T probably null Het
Gm4787 T A 12: 81,377,747 K546* probably null Het
Gm498 G T 7: 143,891,755 G178C probably damaging Het
Gm6576 C G 15: 27,026,000 noncoding transcript Het
Got1 C T 19: 43,524,377 D27N probably benign Het
Gucy2c C T 6: 136,704,249 V946I probably damaging Het
Hectd4 T C 5: 121,349,243 Y3434H possibly damaging Het
Hp1bp3 C T 4: 138,237,209 S348F probably damaging Het
Itpr1 A G 6: 108,471,209 probably benign Het
Kctd1 G A 18: 14,974,180 P743S probably benign Het
Klhl23 T C 2: 69,833,966 V553A probably damaging Het
Krt24 T C 11: 99,280,267 D495G probably damaging Het
L3hypdh C T 12: 72,077,143 probably null Het
Lipo3 C T 19: 33,557,106 probably null Het
Lman2l G T 1: 36,424,864 S171* probably null Het
Lrp1b T C 2: 41,511,508 D378G probably damaging Het
Mpeg1 T C 19: 12,461,223 V15A probably benign Het
Narf C T 11: 121,250,836 R356C probably damaging Het
Nebl T A 2: 17,393,023 Q487H possibly damaging Het
Olfm5 G A 7: 104,160,926 A76V probably benign Het
Olfr1090 T C 2: 86,753,887 M284V probably benign Het
Olfr339 T A 2: 36,422,287 D296E probably benign Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr656 A T 7: 104,618,581 I301F probably damaging Het
Olfr992 T A 2: 85,399,961 S191C probably damaging Het
Palb2 A T 7: 122,128,166 Y160* probably null Het
Paxip1 C T 5: 27,744,185 probably benign Het
Pclo A G 5: 14,679,797 probably benign Het
Pdcd11 G A 19: 47,119,862 V1223I probably benign Het
Pde6c T C 19: 38,169,365 probably benign Het
Prr12 A G 7: 45,050,039 probably benign Het
Prss39 T A 1: 34,502,200 probably benign Het
Samd5 A G 10: 9,674,939 W9R probably damaging Het
Sfr1 A G 19: 47,735,018 *320W probably null Het
Sh3bp4 A G 1: 89,145,314 N628S possibly damaging Het
Sim1 A T 10: 50,907,961 I104F probably damaging Het
Slc1a3 T C 15: 8,636,209 M519V probably benign Het
Smcp T A 3: 92,584,520 T7S unknown Het
Sp4 A G 12: 118,300,816 probably benign Het
Spag9 T A 11: 94,093,539 I327N probably damaging Het
Thbs4 G T 13: 92,754,410 H850N probably benign Het
Ubap2l A T 3: 90,021,373 S478T possibly damaging Het
Unc79 A G 12: 103,088,434 probably benign Het
Vmn2r85 A G 10: 130,419,185 probably benign Het
Wrap73 A G 4: 154,142,500 D19G possibly damaging Het
Other mutations in Map3k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Map3k4 APN 17 12232990 missense probably damaging 1.00
IGL01124:Map3k4 APN 17 12255200 missense probably benign 0.01
IGL01125:Map3k4 APN 17 12271962 missense probably damaging 0.96
IGL01585:Map3k4 APN 17 12248959 missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12248995 missense probably benign 0.30
IGL02194:Map3k4 APN 17 12263928 missense probably damaging 1.00
IGL02292:Map3k4 APN 17 12235158 missense possibly damaging 0.77
IGL02326:Map3k4 APN 17 12249010 missense probably damaging 1.00
IGL02388:Map3k4 APN 17 12271610 missense probably damaging 0.99
IGL02621:Map3k4 APN 17 12264013 missense probably damaging 1.00
IGL02668:Map3k4 APN 17 12235953 missense possibly damaging 0.85
IGL02850:Map3k4 APN 17 12271914 missense probably damaging 1.00
IGL02939:Map3k4 APN 17 12272149 missense probably damaging 1.00
IGL03148:Map3k4 APN 17 12238158 missense probably benign 0.01
IGL03238:Map3k4 APN 17 12271158 missense probably benign 0.10
ANU74:Map3k4 UTSW 17 12232976 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0183:Map3k4 UTSW 17 12235128 missense probably damaging 1.00
R0309:Map3k4 UTSW 17 12271015 frame shift probably null
R0355:Map3k4 UTSW 17 12254171 missense probably damaging 1.00
R0367:Map3k4 UTSW 17 12258041 splice site probably benign
R1103:Map3k4 UTSW 17 12237063 splice site probably null
R1446:Map3k4 UTSW 17 12256794 nonsense probably null
R1542:Map3k4 UTSW 17 12235906 missense probably damaging 0.97
R1713:Map3k4 UTSW 17 12249571 missense probably benign 0.39
R1777:Map3k4 UTSW 17 12271730 missense possibly damaging 0.82
R1797:Map3k4 UTSW 17 12264019 missense probably benign 0.30
R1997:Map3k4 UTSW 17 12254995 critical splice donor site probably null
R2042:Map3k4 UTSW 17 12277983 missense probably damaging 0.99
R2878:Map3k4 UTSW 17 12264067 missense probably benign 0.00
R2939:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R2940:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R3405:Map3k4 UTSW 17 12256781 missense probably damaging 1.00
R3930:Map3k4 UTSW 17 12235993 missense possibly damaging 0.83
R4291:Map3k4 UTSW 17 12255260 missense probably benign 0.08
R4410:Map3k4 UTSW 17 12248998 missense probably damaging 1.00
R4632:Map3k4 UTSW 17 12232504 missense probably damaging 1.00
R4641:Map3k4 UTSW 17 12264045 missense probably damaging 1.00
R4726:Map3k4 UTSW 17 12232964 missense possibly damaging 0.89
R4730:Map3k4 UTSW 17 12248974 missense probably damaging 0.99
R4832:Map3k4 UTSW 17 12271780 missense probably damaging 1.00
R4896:Map3k4 UTSW 17 12272019 missense possibly damaging 0.65
R4934:Map3k4 UTSW 17 12271900 missense probably damaging 1.00
R4971:Map3k4 UTSW 17 12249495 critical splice donor site probably null
R4980:Map3k4 UTSW 17 12272071 missense probably damaging 1.00
R5211:Map3k4 UTSW 17 12232434 missense possibly damaging 0.88
R5337:Map3k4 UTSW 17 12271610 missense probably damaging 0.99
R5356:Map3k4 UTSW 17 12247308 missense possibly damaging 0.87
R5550:Map3k4 UTSW 17 12243558 nonsense probably null
R5824:Map3k4 UTSW 17 12229639 missense probably damaging 1.00
R5890:Map3k4 UTSW 17 12271416 missense probably damaging 1.00
R6285:Map3k4 UTSW 17 12264058 missense probably damaging 1.00
R6380:Map3k4 UTSW 17 12272067 missense possibly damaging 0.56
R6383:Map3k4 UTSW 17 12249583 missense possibly damaging 0.82
R6571:Map3k4 UTSW 17 12242692 missense possibly damaging 0.80
R6584:Map3k4 UTSW 17 12260491 missense probably damaging 1.00
R6616:Map3k4 UTSW 17 12271344 missense probably damaging 1.00
R6644:Map3k4 UTSW 17 12232410 critical splice donor site probably null
R6909:Map3k4 UTSW 17 12270985 missense probably damaging 1.00
R6947:Map3k4 UTSW 17 12260569 nonsense probably null
R6970:Map3k4 UTSW 17 12248916 missense probably damaging 1.00
R7120:Map3k4 UTSW 17 12271467 missense probably damaging 1.00
R7253:Map3k4 UTSW 17 12272068 missense probably benign 0.00
R7267:Map3k4 UTSW 17 12271649 nonsense probably null
R7322:Map3k4 UTSW 17 12270946 missense probably damaging 1.00
R7522:Map3k4 UTSW 17 12261332 missense probably benign 0.39
R7554:Map3k4 UTSW 17 12232413 missense probably damaging 1.00
R7554:Map3k4 UTSW 17 12232414 nonsense probably null
R7734:Map3k4 UTSW 17 12264111 missense probably damaging 1.00
X0067:Map3k4 UTSW 17 12264094 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAAAACCTGGCCCGCATTTAAGAAC -3'
(R):5'- ACGTGTGCCCCACTAAATTCCC -3'

Sequencing Primer
(F):5'- GCCCGCATTTAAGAACTCTGC -3'
(R):5'- CATATCACATGGAGATGCTTGC -3'
Posted On2013-04-11