Incidental Mutation 'R1930:Hsd17b2'
ID215283
Institutional Source Beutler Lab
Gene Symbol Hsd17b2
Ensembl Gene ENSMUSG00000031844
Gene Namehydroxysteroid (17-beta) dehydrogenase 2
Synonyms17 HSD type 2
MMRRC Submission 039948-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1930 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location117701904-117759027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117758904 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 369 (Y369H)
Ref Sequence ENSEMBL: ENSMUSP00000034304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034304]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034304
AA Change: Y369H

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034304
Gene: ENSMUSG00000031844
AA Change: Y369H

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
Pfam:adh_short 84 279 1.3e-48 PFAM
Pfam:KR 85 263 3.6e-7 PFAM
Pfam:DUF1776 85 361 3.2e-13 PFAM
Pfam:adh_short_C2 89 288 1.5e-13 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality starting at E11.5 and placenta defects. The few mutants that survive to birth exhibit enlarged brain ventricles, cerebral cortex abnormalities and a single kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2410002F23Rik T A 7: 44,251,116 D148E probably damaging Het
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
4933430I17Rik A T 4: 62,532,282 D31V possibly damaging Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Ago2 A T 15: 73,119,355 I578N probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Cep152 A T 2: 125,618,371 probably null Het
Chrnb1 A G 11: 69,792,737 L261P possibly damaging Het
Cntn3 C T 6: 102,242,053 W535* probably null Het
Col4a4 A C 1: 82,466,600 probably null Het
Daam2 A T 17: 49,462,213 probably null Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Glt8d2 G T 10: 82,664,642 S91R probably benign Het
H2-Oa A T 17: 34,093,899 H50L possibly damaging Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Ice1 A T 13: 70,605,083 S961R probably benign Het
Ift20 G A 11: 78,540,004 V58I possibly damaging Het
Ippk T A 13: 49,450,018 F367I probably damaging Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Krtcap2 T A 3: 89,247,076 N35K probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Magi3 A T 3: 104,089,604 D208E probably damaging Het
Mc2r T A 18: 68,407,782 T147S probably benign Het
Mfsd4b1 C A 10: 40,006,074 A72S probably benign Het
Msln A T 17: 25,751,922 N150K probably damaging Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfr1264 G A 2: 90,021,161 R302C probably benign Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Pcnx2 C A 8: 125,887,714 V333L probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pkhd1l1 A G 15: 44,503,337 D737G possibly damaging Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Scgb2b20 T C 7: 33,366,196 probably null Het
Sdr16c6 A G 4: 4,058,809 V259A probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc51b T A 9: 65,415,196 E21V probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
Specc1l A G 10: 75,309,824 D1101G probably damaging Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tdg T A 10: 82,641,544 L35Q probably damaging Het
Tekt2 T C 4: 126,322,817 probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Tspyl3 A G 2: 153,224,797 F174L probably damaging Het
Ttn C T 2: 76,722,849 D31099N probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp60 T A 7: 27,736,957 M1K probably null Het
Other mutations in Hsd17b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Hsd17b2 APN 8 117758671 missense probably damaging 0.98
IGL00907:Hsd17b2 APN 8 117734694 missense probably benign 0.00
R0664:Hsd17b2 UTSW 8 117758701 missense possibly damaging 0.67
R1506:Hsd17b2 UTSW 8 117702265 critical splice donor site probably null
R1627:Hsd17b2 UTSW 8 117702170 missense possibly damaging 0.53
R1822:Hsd17b2 UTSW 8 117758749 missense possibly damaging 0.47
R2055:Hsd17b2 UTSW 8 117702174 missense possibly damaging 0.96
R3159:Hsd17b2 UTSW 8 117758752 missense probably damaging 1.00
R6536:Hsd17b2 UTSW 8 117702182 missense possibly damaging 0.96
R8074:Hsd17b2 UTSW 8 117758701 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGAACTATGGCCAGGACTACG -3'
(R):5'- AGTCCTCTTCCCACGAAGTCAC -3'

Sequencing Primer
(F):5'- TCCCGACCTTGAAAGAGAGGTC -3'
(R):5'- TTCCCACGAAGTCACAGGGAAC -3'
Posted On2014-07-14