Incidental Mutation 'R1930:Slc16a5'
ID215295
Institutional Source Beutler Lab
Gene Symbol Slc16a5
Ensembl Gene ENSMUSG00000045775
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 5
SynonymsMCT5, A130015N09Rik
MMRRC Submission 039948-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1930 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115462474-115474398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115469368 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 126 (I126F)
Ref Sequence ENSEMBL: ENSMUSP00000090102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092445] [ENSMUST00000106532] [ENSMUST00000153466]
Predicted Effect probably damaging
Transcript: ENSMUST00000092445
AA Change: I126F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090102
Gene: ENSMUSG00000045775
AA Change: I126F

DomainStartEndE-ValueType
Pfam:MFS_1 15 303 5.9e-31 PFAM
Pfam:MFS_1 302 459 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106532
SMART Domains Protein: ENSMUSP00000102142
Gene: ENSMUSG00000045775

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125251
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146500
Predicted Effect probably benign
Transcript: ENSMUST00000153466
SMART Domains Protein: ENSMUSP00000117727
Gene: ENSMUSG00000045775

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 54 73 N/A INTRINSIC
transmembrane domain 85 107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the monocarboxylate transporter family and the major facilitator superfamily. The encoded protein is localized to the cell membrane and acts as a proton-linked transporter of bumetanide. Transport by the encoded protein is inhibited by four loop diuretics, nateglinide, thiazides, probenecid, and glibenclamide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2410002F23Rik T A 7: 44,251,116 D148E probably damaging Het
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
4933430I17Rik A T 4: 62,532,282 D31V possibly damaging Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Ago2 A T 15: 73,119,355 I578N probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Cep152 A T 2: 125,618,371 probably null Het
Chrnb1 A G 11: 69,792,737 L261P possibly damaging Het
Cntn3 C T 6: 102,242,053 W535* probably null Het
Col4a4 A C 1: 82,466,600 probably null Het
Daam2 A T 17: 49,462,213 probably null Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Glt8d2 G T 10: 82,664,642 S91R probably benign Het
H2-Oa A T 17: 34,093,899 H50L possibly damaging Het
Hsd17b2 T C 8: 117,758,904 Y369H possibly damaging Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Ice1 A T 13: 70,605,083 S961R probably benign Het
Ift20 G A 11: 78,540,004 V58I possibly damaging Het
Ippk T A 13: 49,450,018 F367I probably damaging Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Krtcap2 T A 3: 89,247,076 N35K probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Magi3 A T 3: 104,089,604 D208E probably damaging Het
Mc2r T A 18: 68,407,782 T147S probably benign Het
Mfsd4b1 C A 10: 40,006,074 A72S probably benign Het
Msln A T 17: 25,751,922 N150K probably damaging Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfr1264 G A 2: 90,021,161 R302C probably benign Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Pcnx2 C A 8: 125,887,714 V333L probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pkhd1l1 A G 15: 44,503,337 D737G possibly damaging Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Scgb2b20 T C 7: 33,366,196 probably null Het
Sdr16c6 A G 4: 4,058,809 V259A probably benign Het
Slc51b T A 9: 65,415,196 E21V probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
Specc1l A G 10: 75,309,824 D1101G probably damaging Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tdg T A 10: 82,641,544 L35Q probably damaging Het
Tekt2 T C 4: 126,322,817 probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Tspyl3 A G 2: 153,224,797 F174L probably damaging Het
Ttn C T 2: 76,722,849 D31099N probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp60 T A 7: 27,736,957 M1K probably null Het
Other mutations in Slc16a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Slc16a5 APN 11 115465001 missense probably benign
IGL02190:Slc16a5 APN 11 115462609 start codon destroyed probably null 1.00
IGL02852:Slc16a5 APN 11 115469579 missense probably benign 0.03
IGL02942:Slc16a5 APN 11 115469350 missense possibly damaging 0.50
R0090:Slc16a5 UTSW 11 115464925 missense probably damaging 1.00
R1928:Slc16a5 UTSW 11 115470016 missense probably damaging 0.98
R1931:Slc16a5 UTSW 11 115469368 missense probably damaging 0.99
R5255:Slc16a5 UTSW 11 115462675 missense probably benign 0.13
R5548:Slc16a5 UTSW 11 115469804 missense probably benign 0.32
R5592:Slc16a5 UTSW 11 115472782 missense probably benign 0.05
R5770:Slc16a5 UTSW 11 115472778 missense possibly damaging 0.70
R8381:Slc16a5 UTSW 11 115469890 missense probably benign
Z1176:Slc16a5 UTSW 11 115469372 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTACCTTCCATCATGAAAACTTGG -3'
(R):5'- AGAAGGGGATCCTCTTTGGG -3'

Sequencing Primer
(F):5'- AAAACTTGGAAGTGTGTCTGTCC -3'
(R):5'- GGCTCCACATACACAACAGTGG -3'
Posted On2014-07-14