Incidental Mutation 'R1930:Mc2r'
ID215317
Institutional Source Beutler Lab
Gene Symbol Mc2r
Ensembl Gene ENSMUSG00000045569
Gene Namemelanocortin 2 receptor
Synonymsadrenocorticotropic hormone receptor, Acthr
MMRRC Submission 039948-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1930 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location68406907-68429251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68407782 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 147 (T147S)
Ref Sequence ENSEMBL: ENSMUSP00000058691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052347]
Predicted Effect probably benign
Transcript: ENSMUST00000052347
AA Change: T147S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058691
Gene: ENSMUSG00000045569
AA Change: T147S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 291 2.4e-13 PFAM
Pfam:7tm_1 41 276 1.1e-29 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MC2R encodes one member of the five-member G-protein associated melanocortin receptor family. Melanocortins (melanocyte-stimulating hormones and adrenocorticotropic hormone) are peptides derived from pro-opiomelanocortin (POMC). MC2R is selectively activated by adrenocorticotropic hormone, whereas the other four melanocortin receptors recognize a variety of melanocortin ligands. Mutations in MC2R can result in familial glucocorticoid deficiency. Alternate transcript variants have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality due to impaired gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
2410002F23Rik T A 7: 44,251,116 D148E probably damaging Het
4930590J08Rik T C 6: 91,915,021 V88A probably benign Het
4933430I17Rik A T 4: 62,532,282 D31V possibly damaging Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Ago2 A T 15: 73,119,355 I578N probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bid C T 6: 120,897,255 A110T possibly damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Cep152 A T 2: 125,618,371 probably null Het
Chrnb1 A G 11: 69,792,737 L261P possibly damaging Het
Cntn3 C T 6: 102,242,053 W535* probably null Het
Col4a4 A C 1: 82,466,600 probably null Het
Daam2 A T 17: 49,462,213 probably null Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Glt8d2 G T 10: 82,664,642 S91R probably benign Het
H2-Oa A T 17: 34,093,899 H50L possibly damaging Het
Hsd17b2 T C 8: 117,758,904 Y369H possibly damaging Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Ice1 A T 13: 70,605,083 S961R probably benign Het
Ift20 G A 11: 78,540,004 V58I possibly damaging Het
Ippk T A 13: 49,450,018 F367I probably damaging Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Krtcap2 T A 3: 89,247,076 N35K probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Magi3 A T 3: 104,089,604 D208E probably damaging Het
Mfsd4b1 C A 10: 40,006,074 A72S probably benign Het
Msln A T 17: 25,751,922 N150K probably damaging Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfr1264 G A 2: 90,021,161 R302C probably benign Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Pcnx2 C A 8: 125,887,714 V333L probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pkhd1l1 A G 15: 44,503,337 D737G possibly damaging Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Scgb2b20 T C 7: 33,366,196 probably null Het
Sdr16c6 A G 4: 4,058,809 V259A probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc51b T A 9: 65,415,196 E21V probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
Specc1l A G 10: 75,309,824 D1101G probably damaging Het
Srf C A 17: 46,549,986 G401C probably damaging Het
Stard9 C A 2: 120,673,636 S221R probably damaging Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tdg T A 10: 82,641,544 L35Q probably damaging Het
Tekt2 T C 4: 126,322,817 probably null Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Tspyl3 A G 2: 153,224,797 F174L probably damaging Het
Ttn C T 2: 76,722,849 D31099N probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp60 T A 7: 27,736,957 M1K probably null Het
Other mutations in Mc2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Mc2r APN 18 68408072 missense probably benign 0.07
IGL01866:Mc2r APN 18 68407423 missense possibly damaging 0.81
IGL02002:Mc2r APN 18 68407434 missense probably benign 0.00
PIT4366001:Mc2r UTSW 18 68407755 missense probably benign
R0276:Mc2r UTSW 18 68408132 missense possibly damaging 0.69
R1061:Mc2r UTSW 18 68407809 missense probably damaging 1.00
R1085:Mc2r UTSW 18 68407346 missense probably benign
R1610:Mc2r UTSW 18 68407448 missense probably damaging 1.00
R1688:Mc2r UTSW 18 68408019 missense possibly damaging 0.68
R2184:Mc2r UTSW 18 68408125 missense probably benign 0.02
R2397:Mc2r UTSW 18 68408153 missense probably benign 0.00
R4913:Mc2r UTSW 18 68407340 missense probably benign
R5087:Mc2r UTSW 18 68408203 missense probably benign 0.01
R5506:Mc2r UTSW 18 68407948 nonsense probably null
R5781:Mc2r UTSW 18 68407395 missense possibly damaging 0.69
R5781:Mc2r UTSW 18 68407397 missense probably damaging 1.00
R6364:Mc2r UTSW 18 68407536 missense probably benign 0.00
R7908:Mc2r UTSW 18 68407965 missense probably benign 0.00
R7989:Mc2r UTSW 18 68407965 missense probably benign 0.00
Z1177:Mc2r UTSW 18 68407712 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- ATCTTCCTAGCATGGGAGCG -3'
(R):5'- ATGTTGGGCAGTCTGTATAAGATC -3'

Sequencing Primer
(F):5'- CGGGCAAGTAAGAACATGTG -3'
(R):5'- GGAAAACATCCTGATCATGTTCAG -3'
Posted On2014-07-14