Incidental Mutation 'R1931:Itga4'
ID215331
Institutional Source Beutler Lab
Gene Symbol Itga4
Ensembl Gene ENSMUSG00000027009
Gene Nameintegrin alpha 4
SynonymsVLA-4 receptor, alpha 4 subunit
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location79255426-79333123 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 79313844 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099972]
Predicted Effect probably null
Transcript: ENSMUST00000099972
SMART Domains Protein: ENSMUSP00000099718
Gene: ENSMUSG00000027009

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Int_alpha 48 108 5.14e-7 SMART
Int_alpha 191 241 3.45e1 SMART
Int_alpha 247 300 1.89e-5 SMART
Int_alpha 302 358 2.25e-12 SMART
Int_alpha 364 419 1.45e-15 SMART
Int_alpha 426 483 4.52e-3 SMART
SCOP:d1m1xa2 627 770 1e-35 SMART
Blast:Int_alpha 639 676 9e-16 BLAST
SCOP:d1m1xa3 773 948 7e-42 SMART
transmembrane domain 978 1000 N/A INTRINSIC
PDB:4HKC|B 1003 1032 1e-13 PDB
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of the integrin alpha chain family of proteins. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain that function in cell surface adhesion and signaling. The encoded preproprotein is proteolytically processed to generate light and heavy chains that comprise the alpha 4 subunit. This subunit associates with a beta 1 or beta 7 subunit to form an integrin that may play a role in cell motility and migration. This integrin is a therapeutic target for the treatment of multiple sclerosis, Crohn's disease and inflammatory bowel disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit embryonic lethality either due to failure of chorioallantoic fusion or cardiac abnormalities, including hemorrhage around the heart and defects in epicardium formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Itga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Itga4 APN 2 79292050 missense probably benign 0.01
IGL01317:Itga4 APN 2 79322661 nonsense probably null
IGL01545:Itga4 APN 2 79315970 splice site probably benign
IGL01570:Itga4 APN 2 79322634 critical splice acceptor site probably null
IGL01575:Itga4 APN 2 79288255 missense probably damaging 1.00
IGL01837:Itga4 APN 2 79315005 missense probably damaging 1.00
IGL01974:Itga4 APN 2 79273127 splice site probably benign
IGL02087:Itga4 APN 2 79292069 missense probably damaging 0.99
IGL02245:Itga4 APN 2 79320559 missense probably benign 0.01
IGL02492:Itga4 APN 2 79255657 utr 5 prime probably benign
IGL02809:Itga4 APN 2 79280577 missense probably damaging 1.00
IGL02998:Itga4 APN 2 79277821 missense possibly damaging 0.88
IGL03008:Itga4 APN 2 79325638 missense probably benign
IGL03282:Itga4 APN 2 79325594 missense probably damaging 0.98
IGL03285:Itga4 APN 2 79279166 missense possibly damaging 0.48
IGL03286:Itga4 APN 2 79289362 missense probably damaging 1.00
R0001:Itga4 UTSW 2 79326587 missense probably damaging 0.99
R0045:Itga4 UTSW 2 79301031 missense probably damaging 1.00
R0276:Itga4 UTSW 2 79321493 missense probably damaging 0.99
R0554:Itga4 UTSW 2 79279117 missense probably damaging 1.00
R0556:Itga4 UTSW 2 79325639 missense probably benign
R0785:Itga4 UTSW 2 79289305 missense possibly damaging 0.89
R0787:Itga4 UTSW 2 79279153 missense probably benign 0.01
R1013:Itga4 UTSW 2 79320503 missense probably benign 0.00
R1237:Itga4 UTSW 2 79279146 missense probably null 0.08
R1295:Itga4 UTSW 2 79322689 missense possibly damaging 0.82
R1471:Itga4 UTSW 2 79287032 missense probably benign 0.26
R1559:Itga4 UTSW 2 79315688 missense probably benign 0.04
R1769:Itga4 UTSW 2 79315706 critical splice donor site probably null
R2012:Itga4 UTSW 2 79277794 missense probably damaging 1.00
R2241:Itga4 UTSW 2 79301013 missense probably damaging 1.00
R3793:Itga4 UTSW 2 79279128 missense probably benign 0.01
R4133:Itga4 UTSW 2 79322652 missense probably damaging 1.00
R4204:Itga4 UTSW 2 79279161 missense probably damaging 0.97
R4296:Itga4 UTSW 2 79272799 missense probably damaging 1.00
R4777:Itga4 UTSW 2 79313710 missense possibly damaging 0.87
R4906:Itga4 UTSW 2 79288248 missense probably damaging 1.00
R5048:Itga4 UTSW 2 79273034 missense probably benign 0.04
R5087:Itga4 UTSW 2 79315629 missense possibly damaging 0.95
R5212:Itga4 UTSW 2 79280595 missense probably damaging 1.00
R5213:Itga4 UTSW 2 79320576 missense probably benign 0.29
R5421:Itga4 UTSW 2 79316041 nonsense probably null
R5549:Itga4 UTSW 2 79256267 missense probably damaging 0.98
R5907:Itga4 UTSW 2 79322656 missense probably benign
R5917:Itga4 UTSW 2 79287098 missense probably damaging 1.00
R6309:Itga4 UTSW 2 79279085 missense probably damaging 1.00
R6764:Itga4 UTSW 2 79325614 missense probably benign 0.02
R6787:Itga4 UTSW 2 79289265 missense probably damaging 0.97
R6790:Itga4 UTSW 2 79325614 missense probably benign 0.02
R7051:Itga4 UTSW 2 79318126 missense possibly damaging 0.91
R7311:Itga4 UTSW 2 79256182 missense probably benign
R7520:Itga4 UTSW 2 79300989 missense probably damaging 1.00
R7573:Itga4 UTSW 2 79272993 missense probably benign
R7636:Itga4 UTSW 2 79313832 missense probably benign 0.01
R7889:Itga4 UTSW 2 79316045 missense probably benign 0.05
R7972:Itga4 UTSW 2 79316045 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGTCATCCCATGGTTGTTATTCTAAG -3'
(R):5'- TTGTGTCTCAAGGGCAGGAAG -3'

Sequencing Primer
(F):5'- GGATGGAGAATTTTTACTTCCATTCC -3'
(R):5'- TCTCAAGGGCAGGAAGAACATCTC -3'
Posted On2014-07-14