Incidental Mutation 'R1931:Pdp1'
ID215340
Institutional Source Beutler Lab
Gene Symbol Pdp1
Ensembl Gene ENSMUSG00000049225
Gene Namepyruvate dehyrogenase phosphatase catalytic subunit 1
SynonymsLOC381511, Ppm2c
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11958184-11966452 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11962074 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 79 (I79T)
Ref Sequence ENSEMBL: ENSMUSP00000103937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056050] [ENSMUST00000095144] [ENSMUST00000108297] [ENSMUST00000108299] [ENSMUST00000108301] [ENSMUST00000108302]
Predicted Effect probably benign
Transcript: ENSMUST00000056050
AA Change: I39T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050521
Gene: ENSMUSG00000049225
AA Change: I39T

DomainStartEndE-ValueType
PP2Cc 99 523 3.36e-97 SMART
PP2C_SIG 177 525 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095144
AA Change: I64T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092766
Gene: ENSMUSG00000049225
AA Change: I64T

DomainStartEndE-ValueType
PP2Cc 124 548 3.36e-97 SMART
PP2C_SIG 202 550 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108297
AA Change: I39T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103932
Gene: ENSMUSG00000049225
AA Change: I39T

DomainStartEndE-ValueType
PP2Cc 99 523 3.36e-97 SMART
PP2C_SIG 177 525 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108299
AA Change: I64T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103934
Gene: ENSMUSG00000049225
AA Change: I64T

DomainStartEndE-ValueType
PP2Cc 124 548 3.36e-97 SMART
PP2C_SIG 202 550 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108301
AA Change: I98T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103936
Gene: ENSMUSG00000049225
AA Change: I98T

DomainStartEndE-ValueType
low complexity region 11 18 N/A INTRINSIC
PP2Cc 158 582 3.36e-97 SMART
PP2C_SIG 236 584 2.77e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108302
AA Change: I79T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103937
Gene: ENSMUSG00000049225
AA Change: I79T

DomainStartEndE-ValueType
PP2Cc 139 563 3.36e-97 SMART
PP2C_SIG 217 565 2.77e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146154
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154194
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (E1) is one of the three components (E1, E2, and E3) of the large pyruvate dehydrogenase complex. Pyruvate dehydrogenase kinases catalyze phosphorylation of serine residues of E1 to inactivate the E1 component and inhibit the complex. Pyruvate dehydrogenase phosphatases catalyze the dephosphorylation and activation of the E1 component to reverse the effects of pyruvate dehydrogenase kinases. Pyruvate dehydrogenase phosphatase is a heterodimer consisting of catalytic and regulatory subunits. Two catalytic subunits have been reported; one is predominantly expressed in skeletal muscle and another one is is much more abundant in the liver. The catalytic subunit, encoded by this gene, is the former, and belongs to the protein phosphatase 2C (PP2C) superfamily. Along with the pyruvate dehydrogenase complex and pyruvate dehydrogenase kinases, this enzyme is located in the mitochondrial matrix. Mutation in this gene causes pyruvate dehydrogenase phosphatase deficiency. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Pdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02243:Pdp1 APN 4 11961873 missense probably benign 0.20
IGL02643:Pdp1 APN 4 11962062 missense probably benign
R2162:Pdp1 UTSW 4 11961123 missense probably damaging 0.98
R2418:Pdp1 UTSW 4 11961838 missense probably damaging 0.98
R3843:Pdp1 UTSW 4 11961961 missense probably benign 0.00
R5699:Pdp1 UTSW 4 11960907 missense possibly damaging 0.79
R6479:Pdp1 UTSW 4 11961327 missense probably damaging 1.00
R7221:Pdp1 UTSW 4 11961004 missense probably damaging 0.99
R7263:Pdp1 UTSW 4 11960821 missense possibly damaging 0.82
Z1177:Pdp1 UTSW 4 11961639 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GCTGATTGCTGTCAAATCCAAGAATG -3'
(R):5'- GCTCTCTAGGAATCCCAGTCAG -3'

Sequencing Primer
(F):5'- GCCATCAAATTCTGGTACTTTGAAGC -3'
(R):5'- AGTCAGAACGTCCAGTCTGC -3'
Posted On2014-07-14