Incidental Mutation 'R1931:Coro2a'
ID 215343
Institutional Source Beutler Lab
Gene Symbol Coro2a
Ensembl Gene ENSMUSG00000028337
Gene Name coronin, actin binding protein 2A
Synonyms 9030208C03Rik, IR10, coronin 4
MMRRC Submission 039949-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.075) question?
Stock # R1931 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 46536937-46601929 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) A to T at 46539138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Arginine at position 544 (*544R)
Ref Sequence ENSEMBL: ENSMUSP00000103386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030021] [ENSMUST00000046897] [ENSMUST00000102924] [ENSMUST00000107756] [ENSMUST00000107757] [ENSMUST00000184112]
AlphaFold Q8C0P5
Predicted Effect probably null
Transcript: ENSMUST00000030021
AA Change: *525R
SMART Domains Protein: ENSMUSP00000030021
Gene: ENSMUSG00000028337
AA Change: *525R

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046897
SMART Domains Protein: ENSMUSP00000038719
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
PRY 264 316 2.63e-13 SMART
SPRY 317 440 2.48e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102924
SMART Domains Protein: ENSMUSP00000099988
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107756
AA Change: *525R
SMART Domains Protein: ENSMUSP00000103385
Gene: ENSMUSG00000028337
AA Change: *525R

DomainStartEndE-ValueType
DUF1899 5 69 3.93e-33 SMART
WD40 68 111 2.04e-5 SMART
WD40 121 161 1.58e-2 SMART
WD40 169 208 2.55e-6 SMART
DUF1900 261 397 9.15e-84 SMART
coiled coil region 488 521 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107757
AA Change: *544R
SMART Domains Protein: ENSMUSP00000103386
Gene: ENSMUSG00000028337
AA Change: *544R

DomainStartEndE-ValueType
DUF1899 24 88 3.93e-33 SMART
WD40 87 130 2.04e-5 SMART
WD40 140 180 1.58e-2 SMART
WD40 188 227 2.55e-6 SMART
DUF1900 280 416 9.15e-84 SMART
coiled coil region 507 540 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136978
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142606
Predicted Effect probably benign
Transcript: ENSMUST00000184112
SMART Domains Protein: ENSMUSP00000138876
Gene: ENSMUSG00000039853

DomainStartEndE-ValueType
BBOX 17 59 1.84e-8 SMART
low complexity region 115 126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 5 WD repeats, and has a structural similarity with actin-binding proteins: the D. discoideum coronin and the human p57 protein, suggesting that this protein may also be an actin-binding protein that regulates cell motility. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T G 6: 86,933,318 (GRCm39) S430A unknown Het
Abhd16a T A 17: 35,319,991 (GRCm39) F337L probably benign Het
Acsl1 C A 8: 46,984,023 (GRCm39) A514E probably benign Het
Adam29 T C 8: 56,326,124 (GRCm39) Y110C probably damaging Het
Adamts12 C A 15: 11,270,685 (GRCm39) Q647K probably benign Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamtsl1 A G 4: 86,260,648 (GRCm39) E961G possibly damaging Het
AW011738 T C 4: 156,287,997 (GRCm39) probably benign Het
Bcl9 T C 3: 97,112,460 (GRCm39) M1332V probably damaging Het
Birc6 T C 17: 74,872,977 (GRCm39) I412T probably damaging Het
Cav1 A T 6: 17,339,331 (GRCm39) I139F probably damaging Het
Col4a4 A C 1: 82,444,321 (GRCm39) probably null Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Dennd2c A G 3: 103,040,568 (GRCm39) N278D probably benign Het
Dgkh T C 14: 78,853,945 (GRCm39) I265V probably damaging Het
Dpp3 A T 19: 4,967,888 (GRCm39) probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Ece1 A G 4: 137,666,074 (GRCm39) K306R probably benign Het
Eif4b T C 15: 101,997,411 (GRCm39) S309P unknown Het
Eml3 G A 19: 8,914,507 (GRCm39) V507M probably benign Het
Ezhip T C X: 5,994,817 (GRCm39) E66G probably benign Het
Fat1 C T 8: 45,497,265 (GRCm39) T4250M possibly damaging Het
Fezf1 T G 6: 23,246,906 (GRCm39) I309L probably damaging Het
Fsip2 T A 2: 82,817,077 (GRCm39) L4270H probably damaging Het
Gabra4 T C 5: 71,795,580 (GRCm39) K206E probably damaging Het
Gfm1 A G 3: 67,363,918 (GRCm39) K465E probably benign Het
Gpld1 A T 13: 25,127,693 (GRCm39) I32L possibly damaging Het
H4c12 A T 13: 21,934,682 (GRCm39) probably null Het
Hoxd12 A G 2: 74,505,857 (GRCm39) T143A probably benign Het
Hoxd12 A G 2: 74,505,875 (GRCm39) T149A probably benign Het
Hspg2 T A 4: 137,267,541 (GRCm39) S2050T probably damaging Het
Il31ra T A 13: 112,677,756 (GRCm39) N287I probably damaging Het
Itga4 G A 2: 79,144,188 (GRCm39) probably null Het
Itpr2 A G 6: 146,141,852 (GRCm39) V1730A probably benign Het
Klkb1 T A 8: 45,728,514 (GRCm39) Q415L probably benign Het
Lcn10 A G 2: 25,574,347 (GRCm39) Y118C probably damaging Het
Lgi3 T C 14: 70,773,708 (GRCm39) V294A probably damaging Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Naaa A G 5: 92,425,894 (GRCm39) V33A probably benign Het
Nckap5l A G 15: 99,325,142 (GRCm39) F454L probably damaging Het
Nol10 A G 12: 17,398,555 (GRCm39) M1V probably null Het
Olfm1 G A 2: 28,112,674 (GRCm39) probably null Het
Or2at4 G T 7: 99,385,067 (GRCm39) R239L possibly damaging Het
Or6c208 T A 10: 129,223,745 (GRCm39) M81K probably benign Het
Or7g30 T C 9: 19,352,647 (GRCm39) L146P possibly damaging Het
Osbp2 T C 11: 3,676,333 (GRCm39) probably null Het
Osbpl1a T A 18: 13,038,251 (GRCm39) Q269L probably benign Het
Papss2 T A 19: 32,616,368 (GRCm39) C191* probably null Het
Pbxip1 A T 3: 89,354,984 (GRCm39) probably null Het
Pdp1 A G 4: 11,962,074 (GRCm39) I79T probably benign Het
Peg10 A G 6: 4,755,778 (GRCm39) Y118C probably damaging Het
Pnisr A G 4: 21,873,612 (GRCm39) T452A probably benign Het
Polr2a A T 11: 69,626,201 (GRCm39) Y1612N unknown Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Prr11 A T 11: 86,996,868 (GRCm39) L32* probably null Het
Ptgfr T A 3: 151,540,831 (GRCm39) T226S probably benign Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rps6kb1 A G 11: 86,423,647 (GRCm39) V111A possibly damaging Het
Sfxn1 A T 13: 54,247,952 (GRCm39) I226F probably damaging Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc16a5 A T 11: 115,360,194 (GRCm39) I126F probably damaging Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spata3 A C 1: 85,949,783 (GRCm39) probably benign Het
St8sia6 A G 2: 13,797,623 (GRCm39) S48P probably benign Het
Stra6l A T 4: 45,882,698 (GRCm39) R470* probably null Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Sugp1 T A 8: 70,524,190 (GRCm39) D598E probably benign Het
Tekt2 T C 4: 126,216,610 (GRCm39) probably null Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmprss2 T C 16: 97,370,262 (GRCm39) S301G probably benign Het
Tnrc18 A T 5: 142,762,079 (GRCm39) N515K unknown Het
Togaram1 A G 12: 65,013,709 (GRCm39) Y320C probably damaging Het
Trim41 A G 11: 48,698,319 (GRCm39) V549A probably damaging Het
Ugt2b1 T A 5: 87,065,700 (GRCm39) L446F probably damaging Het
Unc5b T C 10: 60,608,348 (GRCm39) T621A probably benign Het
Utp25 T A 1: 192,800,617 (GRCm39) K401I probably damaging Het
Vmn1r214 C A 13: 23,219,494 (GRCm39) H329Q possibly damaging Het
Vmn2r109 T A 17: 20,774,072 (GRCm39) K428* probably null Het
Vmn2r81 A C 10: 79,129,328 (GRCm39) I740L probably damaging Het
Wdfy3 A G 5: 102,089,358 (GRCm39) L612P probably damaging Het
Zfp109 G A 7: 23,928,161 (GRCm39) T424M probably damaging Het
Zfp735 A T 11: 73,602,677 (GRCm39) K540N possibly damaging Het
Other mutations in Coro2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Coro2a APN 4 46,540,455 (GRCm39) missense probably benign 0.06
IGL03093:Coro2a APN 4 46,544,158 (GRCm39) missense possibly damaging 0.93
lonewolf UTSW 4 46,542,255 (GRCm39) missense probably damaging 1.00
R1562:Coro2a UTSW 4 46,548,917 (GRCm39) missense probably benign 0.02
R1862:Coro2a UTSW 4 46,548,797 (GRCm39) missense possibly damaging 0.93
R4385:Coro2a UTSW 4 46,541,961 (GRCm39) missense possibly damaging 0.93
R5171:Coro2a UTSW 4 46,542,372 (GRCm39) intron probably benign
R5243:Coro2a UTSW 4 46,545,620 (GRCm39) missense probably damaging 1.00
R5393:Coro2a UTSW 4 46,542,255 (GRCm39) missense probably damaging 1.00
R5785:Coro2a UTSW 4 46,564,691 (GRCm39) missense probably benign 0.03
R6014:Coro2a UTSW 4 46,542,261 (GRCm39) missense probably damaging 1.00
R6184:Coro2a UTSW 4 46,540,504 (GRCm39) missense probably benign
R6264:Coro2a UTSW 4 46,562,912 (GRCm39) missense probably damaging 1.00
R6601:Coro2a UTSW 4 46,543,421 (GRCm39) nonsense probably null
R6732:Coro2a UTSW 4 46,551,374 (GRCm39) missense probably damaging 0.99
R6760:Coro2a UTSW 4 46,540,572 (GRCm39) missense probably benign
R7499:Coro2a UTSW 4 46,539,188 (GRCm39) missense probably benign 0.01
R7516:Coro2a UTSW 4 46,562,992 (GRCm39) missense probably benign 0.12
R7567:Coro2a UTSW 4 46,546,674 (GRCm39) missense probably damaging 0.99
R7816:Coro2a UTSW 4 46,546,809 (GRCm39) missense probably benign 0.01
R8008:Coro2a UTSW 4 46,551,349 (GRCm39) missense probably damaging 1.00
R8236:Coro2a UTSW 4 46,548,796 (GRCm39) missense possibly damaging 0.93
R8513:Coro2a UTSW 4 46,544,117 (GRCm39) frame shift probably null
R8515:Coro2a UTSW 4 46,544,117 (GRCm39) frame shift probably null
R9024:Coro2a UTSW 4 46,542,323 (GRCm39) missense probably benign 0.34
R9113:Coro2a UTSW 4 46,563,047 (GRCm39) missense
R9445:Coro2a UTSW 4 46,540,558 (GRCm39) missense probably benign 0.00
R9534:Coro2a UTSW 4 46,548,884 (GRCm39) missense probably benign 0.00
RF012:Coro2a UTSW 4 46,542,336 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCAACTGAGAGTTTTGTTTTCC -3'
(R):5'- TCAGAAGTGTGTGCCTCAGC -3'

Sequencing Primer
(F):5'- ctctctctctctctctctct -3'
(R):5'- AAGTGTGTGCCTCAGCCTCTG -3'
Posted On 2014-07-14