Incidental Mutation 'R1931:Hspg2'
ID 215347
Institutional Source Beutler Lab
Gene Symbol Hspg2
Ensembl Gene ENSMUSG00000028763
Gene Name perlecan (heparan sulfate proteoglycan 2)
Synonyms Plc, Pcn, per
MMRRC Submission 039949-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1931 (G1)
Quality Score 135
Status Not validated
Chromosome 4
Chromosomal Location 137468769-137570630 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137540230 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 2050 (S2050T)
Ref Sequence ENSEMBL: ENSMUSP00000030547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030547] [ENSMUST00000171332]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000030547
AA Change: S2050T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030547
Gene: ENSMUSG00000028763
AA Change: S2050T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1113 1156 7.5e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2056 2117 4.81e-15 SMART
IGc2 2157 2216 1.37e-10 SMART
IGc2 2251 2312 5.88e-10 SMART
low complexity region 2333 2344 N/A INTRINSIC
IGc2 2347 2408 1.97e-11 SMART
IGc2 2441 2502 1.59e-15 SMART
low complexity region 2517 2528 N/A INTRINSIC
IGc2 2538 2599 3.08e-13 SMART
IGc2 2634 2695 9.25e-17 SMART
low complexity region 2704 2728 N/A INTRINSIC
IGc2 2731 2792 1.84e-11 SMART
IGc2 2828 2889 2.11e-11 SMART
IGc2 2926 2987 3.25e-12 SMART
IG 3017 3098 3.62e-10 SMART
IGc2 3114 3180 9.05e-11 SMART
IGc2 3212 3273 2.44e-16 SMART
IGc2 3299 3360 2.26e-11 SMART
IGc2 3400 3461 6.81e-6 SMART
IGc2 3489 3550 1.59e-15 SMART
IGc2 3575 3636 2.54e-14 SMART
LamG 3672 3813 3.41e-39 SMART
EGF 3832 3866 6.91e-9 SMART
EGF 3872 3907 4.46e-3 SMART
LamG 3934 4070 4.78e-43 SMART
EGF 4092 4126 1.17e-6 SMART
EGF 4131 4161 1.87e-5 SMART
LamG 4211 4348 1.33e-41 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171332
AA Change: S2056T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131316
Gene: ENSMUSG00000028763
AA Change: S2056T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 53 78 N/A INTRINSIC
SEA 80 194 4.94e-18 SMART
LDLa 198 236 4.51e-12 SMART
low complexity region 253 267 N/A INTRINSIC
LDLa 284 321 1.62e-13 SMART
LDLa 324 361 2.59e-12 SMART
LDLa 367 405 3.86e-11 SMART
IGc2 419 486 4.06e-13 SMART
LamB 590 717 7.45e-54 SMART
EGF_Lam 764 811 6.05e-14 SMART
EGF_Lam 814 869 3.82e-2 SMART
EGF_like 871 921 6.74e-1 SMART
low complexity region 934 939 N/A INTRINSIC
LamB 985 1112 2.87e-55 SMART
Pfam:Laminin_EGF 1114 1156 7.9e-5 PFAM
EGF_Lam 1159 1206 1.1e-11 SMART
EGF_Lam 1209 1263 2.46e-5 SMART
EGF_Lam 1275 1322 4.96e-10 SMART
LamB 1391 1516 5.3e-59 SMART
EGF_like 1516 1560 3.36e0 SMART
EGF_Lam 1563 1610 2.66e-10 SMART
EGF_Lam 1613 1668 3.73e-5 SMART
IGc2 1688 1752 1.76e-8 SMART
IGc2 1783 1846 5.97e-11 SMART
IGc2 1877 1939 8.57e-12 SMART
IGc2 1967 2031 1.82e-15 SMART
IGc2 2062 2123 4.81e-15 SMART
IGc2 2163 2222 1.37e-10 SMART
IGc2 2257 2318 5.88e-10 SMART
low complexity region 2339 2350 N/A INTRINSIC
IGc2 2353 2414 1.97e-11 SMART
IGc2 2447 2508 1.59e-15 SMART
low complexity region 2523 2534 N/A INTRINSIC
IGc2 2544 2605 3.08e-13 SMART
IGc2 2640 2701 9.25e-17 SMART
low complexity region 2710 2734 N/A INTRINSIC
IGc2 2737 2798 1.84e-11 SMART
IGc2 2836 2897 2.11e-11 SMART
IGc2 2934 2995 3.25e-12 SMART
IG 3025 3106 3.62e-10 SMART
IGc2 3122 3188 9.05e-11 SMART
IGc2 3220 3281 2.44e-16 SMART
IGc2 3307 3368 2.26e-11 SMART
IGc2 3408 3469 6.81e-6 SMART
IGc2 3497 3558 1.59e-15 SMART
IGc2 3583 3644 2.54e-14 SMART
LamG 3680 3821 3.41e-39 SMART
EGF 3840 3874 6.91e-9 SMART
EGF 3880 3915 4.46e-3 SMART
LamG 3942 4078 4.78e-43 SMART
EGF 4100 4134 1.17e-6 SMART
EGF 4139 4169 1.87e-5 SMART
LamG 4219 4356 1.33e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184284
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous targeted null mutants die either at embryonic day 10.5 with cardiac outflow defects and/or brain exencephaly or at birth with skeletal dysplasia including micromelia and craniofacial defects. An exon 3 deletion mutant shows only a lens defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T G 6: 86,956,336 (GRCm38) S430A unknown Het
Abhd16a T A 17: 35,101,015 (GRCm38) F337L probably benign Het
Acsl1 C A 8: 46,530,986 (GRCm38) A514E probably benign Het
Adam29 T C 8: 55,873,089 (GRCm38) Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 (GRCm38) Q647K probably benign Het
Adamts20 T A 15: 94,404,010 (GRCm38) H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 (GRCm38) E961G possibly damaging Het
AW011738 T C 4: 156,203,540 (GRCm38) probably benign Het
Bcl9 T C 3: 97,205,144 (GRCm38) M1332V probably damaging Het
Birc6 T C 17: 74,565,982 (GRCm38) I412T probably damaging Het
Cav1 A T 6: 17,339,332 (GRCm38) I139F probably damaging Het
Col4a4 A C 1: 82,466,600 (GRCm38) probably null Het
Coro2a A T 4: 46,539,138 (GRCm38) *544R probably null Het
Cox15 C T 19: 43,746,785 (GRCm38) R181H probably benign Het
Ddx23 G A 15: 98,650,718 (GRCm38) R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 (GRCm38) N278D probably benign Het
Dgkh T C 14: 78,616,505 (GRCm38) I265V probably damaging Het
Dpp3 A T 19: 4,917,860 (GRCm38) probably benign Het
Drc7 G A 8: 95,071,253 (GRCm38) R433H possibly damaging Het
Ece1 A G 4: 137,938,763 (GRCm38) K306R probably benign Het
Eif4b T C 15: 102,088,976 (GRCm38) S309P unknown Het
Eml3 G A 19: 8,937,143 (GRCm38) V507M probably benign Het
Ezhip T C X: 6,082,763 (GRCm38) E66G probably benign Het
Fat1 C T 8: 45,044,228 (GRCm38) T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 (GRCm38) I309L probably damaging Het
Fsip2 T A 2: 82,986,733 (GRCm38) L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 (GRCm38) K206E probably damaging Het
Gfm1 A G 3: 67,456,585 (GRCm38) K465E probably benign Het
Gpld1 A T 13: 24,943,710 (GRCm38) I32L possibly damaging Het
H4c12 A T 13: 21,750,512 (GRCm38) probably null Het
Hoxd12 A G 2: 74,675,513 (GRCm38) T143A probably benign Het
Hoxd12 A G 2: 74,675,531 (GRCm38) T149A probably benign Het
Il31ra T A 13: 112,541,222 (GRCm38) N287I probably damaging Het
Itga4 G A 2: 79,313,844 (GRCm38) probably null Het
Itpr2 A G 6: 146,240,354 (GRCm38) V1730A probably benign Het
Klkb1 T A 8: 45,275,477 (GRCm38) Q415L probably benign Het
Lcn10 A G 2: 25,684,335 (GRCm38) Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 (GRCm38) V294A probably damaging Het
Lrp5 C T 19: 3,610,131 (GRCm38) V978I probably benign Het
Naaa A G 5: 92,278,035 (GRCm38) V33A probably benign Het
Nckap5l A G 15: 99,427,261 (GRCm38) F454L probably damaging Het
Nol10 A G 12: 17,348,554 (GRCm38) M1V probably null Het
Olfm1 G A 2: 28,222,662 (GRCm38) probably null Het
Or2at4 G T 7: 99,735,860 (GRCm38) R239L possibly damaging Het
Or6c208 T A 10: 129,387,876 (GRCm38) M81K probably benign Het
Or7g30 T C 9: 19,441,351 (GRCm38) L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 (GRCm38) probably null Het
Osbpl1a T A 18: 12,905,194 (GRCm38) Q269L probably benign Het
Papss2 T A 19: 32,638,968 (GRCm38) C191* probably null Het
Pbxip1 A T 3: 89,447,677 (GRCm38) probably null Het
Pdp1 A G 4: 11,962,074 (GRCm38) I79T probably benign Het
Peg10 A G 6: 4,755,778 (GRCm38) Y118C probably damaging Het
Pnisr A G 4: 21,873,612 (GRCm38) T452A probably benign Het
Polr2a A T 11: 69,735,375 (GRCm38) Y1612N unknown Het
Polr3c A T 3: 96,719,298 (GRCm38) L270H probably damaging Het
Prr11 A T 11: 87,106,042 (GRCm38) L32* probably null Het
Ptgfr T A 3: 151,835,194 (GRCm38) T226S probably benign Het
Ptprz1 T A 6: 23,007,355 (GRCm38) V1639E probably damaging Het
Pttg1ip2 C A 5: 5,452,019 (GRCm38) W144C probably benign Het
Rps6kb1 A G 11: 86,532,821 (GRCm38) V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 (GRCm38) I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 (GRCm38) S924P probably benign Het
Slc16a5 A T 11: 115,469,368 (GRCm38) I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 (GRCm38) T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 (GRCm38) probably null Het
Spata3 A C 1: 86,022,061 (GRCm38) probably benign Het
St8sia6 A G 2: 13,792,812 (GRCm38) S48P probably benign Het
Stra6l A T 4: 45,882,698 (GRCm38) R470* probably null Het
Stradb A C 1: 58,991,105 (GRCm38) N173H probably benign Het
Sugp1 T A 8: 70,071,540 (GRCm38) D598E probably benign Het
Tekt2 T C 4: 126,322,817 (GRCm38) probably null Het
Tiam2 C T 17: 3,514,725 (GRCm38) R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 (GRCm38) S301G probably benign Het
Tnrc18 A T 5: 142,776,324 (GRCm38) N515K unknown Het
Togaram1 A G 12: 64,966,935 (GRCm38) Y320C probably damaging Het
Trim41 A G 11: 48,807,492 (GRCm38) V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 (GRCm38) L446F probably damaging Het
Unc5b T C 10: 60,772,569 (GRCm38) T621A probably benign Het
Utp25 T A 1: 193,118,309 (GRCm38) K401I probably damaging Het
Vmn1r214 C A 13: 23,035,324 (GRCm38) H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 (GRCm38) K428* probably null Het
Vmn2r81 A C 10: 79,293,494 (GRCm38) I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 (GRCm38) L612P probably damaging Het
Zfp109 G A 7: 24,228,736 (GRCm38) T424M probably damaging Het
Zfp735 A T 11: 73,711,851 (GRCm38) K540N possibly damaging Het
Other mutations in Hspg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Hspg2 APN 4 137,528,820 (GRCm38) missense probably damaging 1.00
IGL00339:Hspg2 APN 4 137,539,195 (GRCm38) missense probably damaging 1.00
IGL00943:Hspg2 APN 4 137,562,201 (GRCm38) missense probably benign 0.15
IGL00970:Hspg2 APN 4 137,542,590 (GRCm38) missense probably benign 0.09
IGL01011:Hspg2 APN 4 137,559,335 (GRCm38) missense probably damaging 1.00
IGL01148:Hspg2 APN 4 137,546,658 (GRCm38) missense probably benign 0.11
IGL01333:Hspg2 APN 4 137,540,314 (GRCm38) missense probably damaging 1.00
IGL01367:Hspg2 APN 4 137,538,489 (GRCm38) missense probably damaging 1.00
IGL01455:Hspg2 APN 4 137,553,817 (GRCm38) missense probably damaging 1.00
IGL01540:Hspg2 APN 4 137,519,706 (GRCm38) missense probably damaging 1.00
IGL01578:Hspg2 APN 4 137,539,183 (GRCm38) missense probably damaging 1.00
IGL01603:Hspg2 APN 4 137,552,803 (GRCm38) missense probably damaging 1.00
IGL01632:Hspg2 APN 4 137,514,773 (GRCm38) missense probably damaging 1.00
IGL01658:Hspg2 APN 4 137,564,926 (GRCm38) missense probably damaging 1.00
IGL01760:Hspg2 APN 4 137,512,671 (GRCm38) missense possibly damaging 0.60
IGL01976:Hspg2 APN 4 137,561,926 (GRCm38) missense probably damaging 1.00
IGL02024:Hspg2 APN 4 137,540,073 (GRCm38) missense probably damaging 1.00
IGL02033:Hspg2 APN 4 137,552,254 (GRCm38) missense probably benign
IGL02051:Hspg2 APN 4 137,568,389 (GRCm38) unclassified probably benign
IGL02124:Hspg2 APN 4 137,518,814 (GRCm38) splice site probably null
IGL02128:Hspg2 APN 4 137,564,016 (GRCm38) missense probably damaging 1.00
IGL02177:Hspg2 APN 4 137,515,316 (GRCm38) missense probably damaging 1.00
IGL02230:Hspg2 APN 4 137,518,645 (GRCm38) missense probably damaging 1.00
IGL02266:Hspg2 APN 4 137,510,577 (GRCm38) missense probably damaging 1.00
IGL02313:Hspg2 APN 4 137,508,389 (GRCm38) missense probably benign 0.03
IGL02477:Hspg2 APN 4 137,544,512 (GRCm38) splice site probably benign
IGL02514:Hspg2 APN 4 137,569,576 (GRCm38) missense probably benign 0.09
IGL02613:Hspg2 APN 4 137,544,420 (GRCm38) missense probably damaging 1.00
IGL02625:Hspg2 APN 4 137,512,642 (GRCm38) missense probably damaging 1.00
IGL02646:Hspg2 APN 4 137,551,848 (GRCm38) missense possibly damaging 0.60
IGL02651:Hspg2 APN 4 137,557,445 (GRCm38) splice site probably benign
IGL02701:Hspg2 APN 4 137,557,174 (GRCm38) missense probably damaging 0.96
IGL02833:Hspg2 APN 4 137,555,130 (GRCm38) missense probably benign 0.00
IGL02985:Hspg2 APN 4 137,507,803 (GRCm38) missense probably damaging 1.00
IGL03040:Hspg2 APN 4 137,561,825 (GRCm38) critical splice donor site probably null
IGL03181:Hspg2 APN 4 137,515,937 (GRCm38) missense probably damaging 1.00
IGL03349:Hspg2 APN 4 137,560,522 (GRCm38) splice site probably benign
G1patch:Hspg2 UTSW 4 137,515,307 (GRCm38) missense probably damaging 1.00
PIT4305001:Hspg2 UTSW 4 137,550,373 (GRCm38) missense possibly damaging 0.55
R0006:Hspg2 UTSW 4 137,519,931 (GRCm38) missense probably damaging 1.00
R0036:Hspg2 UTSW 4 137,542,849 (GRCm38) missense probably damaging 1.00
R0109:Hspg2 UTSW 4 137,562,201 (GRCm38) missense probably benign 0.15
R0131:Hspg2 UTSW 4 137,551,887 (GRCm38) missense probably damaging 1.00
R0131:Hspg2 UTSW 4 137,551,887 (GRCm38) missense probably damaging 1.00
R0132:Hspg2 UTSW 4 137,551,887 (GRCm38) missense probably damaging 1.00
R0245:Hspg2 UTSW 4 137,514,722 (GRCm38) missense probably damaging 1.00
R0388:Hspg2 UTSW 4 137,511,158 (GRCm38) missense probably damaging 1.00
R0389:Hspg2 UTSW 4 137,515,423 (GRCm38) missense possibly damaging 0.53
R0468:Hspg2 UTSW 4 137,533,529 (GRCm38) missense probably damaging 1.00
R0480:Hspg2 UTSW 4 137,550,024 (GRCm38) missense probably damaging 1.00
R0546:Hspg2 UTSW 4 137,502,294 (GRCm38) missense probably benign
R0599:Hspg2 UTSW 4 137,512,401 (GRCm38) missense probably damaging 0.98
R0652:Hspg2 UTSW 4 137,514,722 (GRCm38) missense probably damaging 1.00
R0671:Hspg2 UTSW 4 137,553,280 (GRCm38) missense probably damaging 1.00
R0760:Hspg2 UTSW 4 137,512,349 (GRCm38) missense probably damaging 1.00
R0883:Hspg2 UTSW 4 137,541,440 (GRCm38) missense probably benign 0.00
R1403:Hspg2 UTSW 4 137,540,100 (GRCm38) missense possibly damaging 0.90
R1417:Hspg2 UTSW 4 137,517,636 (GRCm38) missense probably benign
R1497:Hspg2 UTSW 4 137,548,096 (GRCm38) missense probably damaging 0.98
R1509:Hspg2 UTSW 4 137,511,241 (GRCm38) splice site probably benign
R1625:Hspg2 UTSW 4 137,518,971 (GRCm38) missense probably benign 0.23
R1630:Hspg2 UTSW 4 137,518,435 (GRCm38) missense probably damaging 1.00
R1651:Hspg2 UTSW 4 137,533,437 (GRCm38) nonsense probably null
R1699:Hspg2 UTSW 4 137,548,012 (GRCm38) splice site probably null
R1703:Hspg2 UTSW 4 137,559,151 (GRCm38) missense probably damaging 1.00
R1761:Hspg2 UTSW 4 137,514,673 (GRCm38) missense possibly damaging 0.90
R1775:Hspg2 UTSW 4 137,520,156 (GRCm38) missense probably damaging 0.99
R1779:Hspg2 UTSW 4 137,518,509 (GRCm38) missense probably damaging 1.00
R1843:Hspg2 UTSW 4 137,545,567 (GRCm38) missense probably damaging 1.00
R1891:Hspg2 UTSW 4 137,565,490 (GRCm38) missense probably damaging 1.00
R1930:Hspg2 UTSW 4 137,540,230 (GRCm38) missense probably damaging 1.00
R1942:Hspg2 UTSW 4 137,542,552 (GRCm38) missense possibly damaging 0.67
R1959:Hspg2 UTSW 4 137,564,895 (GRCm38) missense probably damaging 1.00
R2042:Hspg2 UTSW 4 137,568,366 (GRCm38) missense probably damaging 1.00
R2062:Hspg2 UTSW 4 137,559,367 (GRCm38) missense possibly damaging 0.79
R2098:Hspg2 UTSW 4 137,520,109 (GRCm38) missense probably damaging 1.00
R2158:Hspg2 UTSW 4 137,517,604 (GRCm38) missense probably damaging 1.00
R2280:Hspg2 UTSW 4 137,522,043 (GRCm38) missense probably damaging 1.00
R2890:Hspg2 UTSW 4 137,549,574 (GRCm38) missense probably damaging 1.00
R2927:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R3428:Hspg2 UTSW 4 137,555,290 (GRCm38) missense probably damaging 1.00
R3744:Hspg2 UTSW 4 137,565,504 (GRCm38) splice site probably benign
R3873:Hspg2 UTSW 4 137,539,349 (GRCm38) missense probably damaging 1.00
R3874:Hspg2 UTSW 4 137,539,349 (GRCm38) missense probably damaging 1.00
R3917:Hspg2 UTSW 4 137,559,314 (GRCm38) missense probably damaging 1.00
R3932:Hspg2 UTSW 4 137,515,568 (GRCm38) missense probably damaging 0.99
R3933:Hspg2 UTSW 4 137,515,568 (GRCm38) missense probably damaging 0.99
R4134:Hspg2 UTSW 4 137,556,657 (GRCm38) missense probably damaging 0.99
R4272:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4273:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4274:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4275:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4288:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4289:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4354:Hspg2 UTSW 4 137,468,911 (GRCm38) missense probably benign 0.17
R4355:Hspg2 UTSW 4 137,529,418 (GRCm38) missense probably damaging 0.98
R4400:Hspg2 UTSW 4 137,548,122 (GRCm38) missense probably benign 0.01
R4411:Hspg2 UTSW 4 137,562,224 (GRCm38) missense probably benign
R4421:Hspg2 UTSW 4 137,548,122 (GRCm38) missense probably benign 0.01
R4592:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4612:Hspg2 UTSW 4 137,539,575 (GRCm38) missense possibly damaging 0.80
R4612:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4619:Hspg2 UTSW 4 137,546,573 (GRCm38) missense probably damaging 1.00
R4658:Hspg2 UTSW 4 137,533,730 (GRCm38) missense probably damaging 1.00
R4667:Hspg2 UTSW 4 137,539,645 (GRCm38) missense possibly damaging 0.90
R4724:Hspg2 UTSW 4 137,522,127 (GRCm38) missense probably damaging 0.96
R4739:Hspg2 UTSW 4 137,570,073 (GRCm38) unclassified probably benign
R4793:Hspg2 UTSW 4 137,529,473 (GRCm38) missense possibly damaging 0.95
R4826:Hspg2 UTSW 4 137,565,395 (GRCm38) missense probably damaging 1.00
R4838:Hspg2 UTSW 4 137,541,666 (GRCm38) missense possibly damaging 0.53
R4896:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R4926:Hspg2 UTSW 4 137,542,530 (GRCm38) missense probably damaging 1.00
R4939:Hspg2 UTSW 4 137,508,031 (GRCm38) missense probably damaging 1.00
R5032:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R5033:Hspg2 UTSW 4 137,518,940 (GRCm38) missense probably damaging 1.00
R5071:Hspg2 UTSW 4 137,540,230 (GRCm38) missense probably damaging 1.00
R5072:Hspg2 UTSW 4 137,540,230 (GRCm38) missense probably damaging 1.00
R5114:Hspg2 UTSW 4 137,511,926 (GRCm38) missense probably damaging 1.00
R5177:Hspg2 UTSW 4 137,518,772 (GRCm38) missense probably damaging 1.00
R5223:Hspg2 UTSW 4 137,543,914 (GRCm38) missense probably damaging 1.00
R5433:Hspg2 UTSW 4 137,528,794 (GRCm38) splice site probably null
R5529:Hspg2 UTSW 4 137,551,828 (GRCm38) missense probably damaging 1.00
R5541:Hspg2 UTSW 4 137,542,825 (GRCm38) missense probably benign 0.17
R5541:Hspg2 UTSW 4 137,520,551 (GRCm38) missense probably damaging 1.00
R5546:Hspg2 UTSW 4 137,548,174 (GRCm38) critical splice donor site probably null
R5728:Hspg2 UTSW 4 137,542,766 (GRCm38) missense possibly damaging 0.95
R5764:Hspg2 UTSW 4 137,561,721 (GRCm38) missense probably damaging 1.00
R5920:Hspg2 UTSW 4 137,553,782 (GRCm38) missense probably damaging 1.00
R5934:Hspg2 UTSW 4 137,518,772 (GRCm38) missense probably damaging 1.00
R6074:Hspg2 UTSW 4 137,540,735 (GRCm38) missense probably benign
R6164:Hspg2 UTSW 4 137,514,655 (GRCm38) missense possibly damaging 0.89
R6175:Hspg2 UTSW 4 137,569,518 (GRCm38) missense probably damaging 1.00
R6217:Hspg2 UTSW 4 137,540,248 (GRCm38) missense probably damaging 0.99
R6262:Hspg2 UTSW 4 137,519,686 (GRCm38) missense probably damaging 1.00
R6299:Hspg2 UTSW 4 137,544,705 (GRCm38) missense probably damaging 1.00
R6333:Hspg2 UTSW 4 137,561,955 (GRCm38) missense probably damaging 1.00
R6371:Hspg2 UTSW 4 137,541,695 (GRCm38) missense probably damaging 1.00
R6430:Hspg2 UTSW 4 137,539,396 (GRCm38) missense probably damaging 1.00
R6498:Hspg2 UTSW 4 137,507,801 (GRCm38) missense possibly damaging 0.46
R6522:Hspg2 UTSW 4 137,555,275 (GRCm38) missense probably damaging 1.00
R6680:Hspg2 UTSW 4 137,565,737 (GRCm38) missense probably benign 0.18
R6724:Hspg2 UTSW 4 137,515,307 (GRCm38) missense probably damaging 1.00
R6725:Hspg2 UTSW 4 137,515,307 (GRCm38) missense probably damaging 1.00
R6762:Hspg2 UTSW 4 137,551,803 (GRCm38) missense possibly damaging 0.83
R6785:Hspg2 UTSW 4 137,508,398 (GRCm38) missense probably damaging 0.99
R6788:Hspg2 UTSW 4 137,515,307 (GRCm38) missense probably damaging 1.00
R6931:Hspg2 UTSW 4 137,540,720 (GRCm38) missense probably damaging 1.00
R6959:Hspg2 UTSW 4 137,519,289 (GRCm38) missense probably benign 0.45
R6968:Hspg2 UTSW 4 137,535,156 (GRCm38) missense probably damaging 1.00
R6988:Hspg2 UTSW 4 137,528,890 (GRCm38) missense probably damaging 1.00
R7021:Hspg2 UTSW 4 137,542,269 (GRCm38) missense possibly damaging 0.69
R7089:Hspg2 UTSW 4 137,544,366 (GRCm38) missense possibly damaging 0.51
R7107:Hspg2 UTSW 4 137,510,652 (GRCm38) missense probably damaging 1.00
R7141:Hspg2 UTSW 4 137,552,116 (GRCm38) missense probably damaging 1.00
R7161:Hspg2 UTSW 4 137,514,719 (GRCm38) missense probably damaging 1.00
R7189:Hspg2 UTSW 4 137,533,561 (GRCm38) critical splice donor site probably null
R7238:Hspg2 UTSW 4 137,508,393 (GRCm38) missense probably damaging 1.00
R7253:Hspg2 UTSW 4 137,519,946 (GRCm38) missense probably benign 0.15
R7278:Hspg2 UTSW 4 137,551,125 (GRCm38) missense probably damaging 0.98
R7287:Hspg2 UTSW 4 137,529,556 (GRCm38) missense probably benign 0.00
R7390:Hspg2 UTSW 4 137,539,179 (GRCm38) missense probably damaging 1.00
R7436:Hspg2 UTSW 4 137,515,664 (GRCm38) missense probably damaging 0.99
R7479:Hspg2 UTSW 4 137,539,403 (GRCm38) missense probably benign 0.17
R7516:Hspg2 UTSW 4 137,542,620 (GRCm38) missense possibly damaging 0.94
R7540:Hspg2 UTSW 4 137,541,440 (GRCm38) missense possibly damaging 0.51
R7603:Hspg2 UTSW 4 137,557,192 (GRCm38) missense possibly damaging 0.91
R7603:Hspg2 UTSW 4 137,548,368 (GRCm38) missense probably damaging 1.00
R7625:Hspg2 UTSW 4 137,564,938 (GRCm38) missense probably damaging 1.00
R7696:Hspg2 UTSW 4 137,511,966 (GRCm38) missense possibly damaging 0.78
R7767:Hspg2 UTSW 4 137,511,866 (GRCm38) missense probably damaging 1.00
R7815:Hspg2 UTSW 4 137,512,464 (GRCm38) missense probably damaging 1.00
R7825:Hspg2 UTSW 4 137,558,849 (GRCm38) missense probably damaging 1.00
R7863:Hspg2 UTSW 4 137,564,824 (GRCm38) missense probably benign 0.03
R7885:Hspg2 UTSW 4 137,516,837 (GRCm38) missense probably damaging 1.00
R7899:Hspg2 UTSW 4 137,548,116 (GRCm38) missense possibly damaging 0.72
R7937:Hspg2 UTSW 4 137,550,932 (GRCm38) missense probably benign 0.01
R7975:Hspg2 UTSW 4 137,555,221 (GRCm38) missense probably benign 0.26
R8078:Hspg2 UTSW 4 137,508,022 (GRCm38) missense probably damaging 1.00
R8285:Hspg2 UTSW 4 137,512,663 (GRCm38) missense probably benign 0.18
R8314:Hspg2 UTSW 4 137,539,675 (GRCm38) missense probably benign 0.12
R8322:Hspg2 UTSW 4 137,518,979 (GRCm38) missense possibly damaging 0.88
R8323:Hspg2 UTSW 4 137,518,979 (GRCm38) missense possibly damaging 0.88
R8324:Hspg2 UTSW 4 137,518,979 (GRCm38) missense possibly damaging 0.88
R8341:Hspg2 UTSW 4 137,518,979 (GRCm38) missense possibly damaging 0.88
R8383:Hspg2 UTSW 4 137,544,370 (GRCm38) missense possibly damaging 0.66
R8425:Hspg2 UTSW 4 137,550,867 (GRCm38) nonsense probably null
R8491:Hspg2 UTSW 4 137,553,719 (GRCm38) missense probably benign 0.00
R8525:Hspg2 UTSW 4 137,539,448 (GRCm38) missense probably damaging 0.98
R8978:Hspg2 UTSW 4 137,564,030 (GRCm38) missense probably benign 0.09
R9152:Hspg2 UTSW 4 137,522,565 (GRCm38) missense possibly damaging 0.89
R9166:Hspg2 UTSW 4 137,542,874 (GRCm38) missense probably damaging 1.00
R9175:Hspg2 UTSW 4 137,529,346 (GRCm38) missense probably damaging 0.98
R9210:Hspg2 UTSW 4 137,562,479 (GRCm38) missense probably benign 0.05
R9221:Hspg2 UTSW 4 137,560,415 (GRCm38) missense possibly damaging 0.79
R9325:Hspg2 UTSW 4 137,538,241 (GRCm38) missense probably damaging 1.00
R9339:Hspg2 UTSW 4 137,551,169 (GRCm38) missense probably benign
R9340:Hspg2 UTSW 4 137,569,516 (GRCm38) missense probably damaging 1.00
R9358:Hspg2 UTSW 4 137,517,598 (GRCm38) missense probably damaging 1.00
R9451:Hspg2 UTSW 4 137,511,069 (GRCm38) missense probably damaging 1.00
R9534:Hspg2 UTSW 4 137,540,761 (GRCm38) missense probably benign
R9656:Hspg2 UTSW 4 137,551,885 (GRCm38) missense probably benign
R9664:Hspg2 UTSW 4 137,539,576 (GRCm38) missense probably benign 0.03
R9695:Hspg2 UTSW 4 137,538,390 (GRCm38) missense probably damaging 1.00
R9741:Hspg2 UTSW 4 137,512,651 (GRCm38) missense probably damaging 1.00
V5622:Hspg2 UTSW 4 137,533,738 (GRCm38) missense probably damaging 0.99
V5622:Hspg2 UTSW 4 137,533,738 (GRCm38) missense probably damaging 0.99
X0028:Hspg2 UTSW 4 137,550,391 (GRCm38) missense probably benign
Z1177:Hspg2 UTSW 4 137,568,373 (GRCm38) missense possibly damaging 0.64
Z1177:Hspg2 UTSW 4 137,564,518 (GRCm38) missense probably damaging 0.99
Z1177:Hspg2 UTSW 4 137,550,467 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTCTCCATGTACGTGGCAG -3'
(R):5'- TGTGCCTCCATCCCAAGTAC -3'

Sequencing Primer
(F):5'- ATTACAGCTGCTGACGCTG -3'
(R):5'- CCAAGTACCAGCCCCAGG -3'
Posted On 2014-07-14