Incidental Mutation 'R1931:Ece1'
ID 215348
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Name endothelin converting enzyme 1
Synonyms
MMRRC Submission 039949-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.800) question?
Stock # R1931 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 137589548-137692540 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 137666074 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 306 (K306R)
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518] [ENSMUST00000151110]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000102518
AA Change: K306R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: K306R

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151110
SMART Domains Protein: ENSMUSP00000114671
Gene: ENSMUSG00000057530

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
Pfam:Peptidase_M13_N 121 206 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T G 6: 86,933,318 (GRCm39) S430A unknown Het
Abhd16a T A 17: 35,319,991 (GRCm39) F337L probably benign Het
Acsl1 C A 8: 46,984,023 (GRCm39) A514E probably benign Het
Adam29 T C 8: 56,326,124 (GRCm39) Y110C probably damaging Het
Adamts12 C A 15: 11,270,685 (GRCm39) Q647K probably benign Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamtsl1 A G 4: 86,260,648 (GRCm39) E961G possibly damaging Het
AW011738 T C 4: 156,287,997 (GRCm39) probably benign Het
Bcl9 T C 3: 97,112,460 (GRCm39) M1332V probably damaging Het
Birc6 T C 17: 74,872,977 (GRCm39) I412T probably damaging Het
Cav1 A T 6: 17,339,331 (GRCm39) I139F probably damaging Het
Col4a4 A C 1: 82,444,321 (GRCm39) probably null Het
Coro2a A T 4: 46,539,138 (GRCm39) *544R probably null Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Dennd2c A G 3: 103,040,568 (GRCm39) N278D probably benign Het
Dgkh T C 14: 78,853,945 (GRCm39) I265V probably damaging Het
Dpp3 A T 19: 4,967,888 (GRCm39) probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Eif4b T C 15: 101,997,411 (GRCm39) S309P unknown Het
Eml3 G A 19: 8,914,507 (GRCm39) V507M probably benign Het
Ezhip T C X: 5,994,817 (GRCm39) E66G probably benign Het
Fat1 C T 8: 45,497,265 (GRCm39) T4250M possibly damaging Het
Fezf1 T G 6: 23,246,906 (GRCm39) I309L probably damaging Het
Fsip2 T A 2: 82,817,077 (GRCm39) L4270H probably damaging Het
Gabra4 T C 5: 71,795,580 (GRCm39) K206E probably damaging Het
Gfm1 A G 3: 67,363,918 (GRCm39) K465E probably benign Het
Gpld1 A T 13: 25,127,693 (GRCm39) I32L possibly damaging Het
H4c12 A T 13: 21,934,682 (GRCm39) probably null Het
Hoxd12 A G 2: 74,505,857 (GRCm39) T143A probably benign Het
Hoxd12 A G 2: 74,505,875 (GRCm39) T149A probably benign Het
Hspg2 T A 4: 137,267,541 (GRCm39) S2050T probably damaging Het
Il31ra T A 13: 112,677,756 (GRCm39) N287I probably damaging Het
Itga4 G A 2: 79,144,188 (GRCm39) probably null Het
Itpr2 A G 6: 146,141,852 (GRCm39) V1730A probably benign Het
Klkb1 T A 8: 45,728,514 (GRCm39) Q415L probably benign Het
Lcn10 A G 2: 25,574,347 (GRCm39) Y118C probably damaging Het
Lgi3 T C 14: 70,773,708 (GRCm39) V294A probably damaging Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Naaa A G 5: 92,425,894 (GRCm39) V33A probably benign Het
Nckap5l A G 15: 99,325,142 (GRCm39) F454L probably damaging Het
Nol10 A G 12: 17,398,555 (GRCm39) M1V probably null Het
Olfm1 G A 2: 28,112,674 (GRCm39) probably null Het
Or2at4 G T 7: 99,385,067 (GRCm39) R239L possibly damaging Het
Or6c208 T A 10: 129,223,745 (GRCm39) M81K probably benign Het
Or7g30 T C 9: 19,352,647 (GRCm39) L146P possibly damaging Het
Osbp2 T C 11: 3,676,333 (GRCm39) probably null Het
Osbpl1a T A 18: 13,038,251 (GRCm39) Q269L probably benign Het
Papss2 T A 19: 32,616,368 (GRCm39) C191* probably null Het
Pbxip1 A T 3: 89,354,984 (GRCm39) probably null Het
Pdp1 A G 4: 11,962,074 (GRCm39) I79T probably benign Het
Peg10 A G 6: 4,755,778 (GRCm39) Y118C probably damaging Het
Pnisr A G 4: 21,873,612 (GRCm39) T452A probably benign Het
Polr2a A T 11: 69,626,201 (GRCm39) Y1612N unknown Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Prr11 A T 11: 86,996,868 (GRCm39) L32* probably null Het
Ptgfr T A 3: 151,540,831 (GRCm39) T226S probably benign Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rps6kb1 A G 11: 86,423,647 (GRCm39) V111A possibly damaging Het
Sfxn1 A T 13: 54,247,952 (GRCm39) I226F probably damaging Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc16a5 A T 11: 115,360,194 (GRCm39) I126F probably damaging Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spata3 A C 1: 85,949,783 (GRCm39) probably benign Het
St8sia6 A G 2: 13,797,623 (GRCm39) S48P probably benign Het
Stra6l A T 4: 45,882,698 (GRCm39) R470* probably null Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Sugp1 T A 8: 70,524,190 (GRCm39) D598E probably benign Het
Tekt2 T C 4: 126,216,610 (GRCm39) probably null Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmprss2 T C 16: 97,370,262 (GRCm39) S301G probably benign Het
Tnrc18 A T 5: 142,762,079 (GRCm39) N515K unknown Het
Togaram1 A G 12: 65,013,709 (GRCm39) Y320C probably damaging Het
Trim41 A G 11: 48,698,319 (GRCm39) V549A probably damaging Het
Ugt2b1 T A 5: 87,065,700 (GRCm39) L446F probably damaging Het
Unc5b T C 10: 60,608,348 (GRCm39) T621A probably benign Het
Utp25 T A 1: 192,800,617 (GRCm39) K401I probably damaging Het
Vmn1r214 C A 13: 23,219,494 (GRCm39) H329Q possibly damaging Het
Vmn2r109 T A 17: 20,774,072 (GRCm39) K428* probably null Het
Vmn2r81 A C 10: 79,129,328 (GRCm39) I740L probably damaging Het
Wdfy3 A G 5: 102,089,358 (GRCm39) L612P probably damaging Het
Zfp109 G A 7: 23,928,161 (GRCm39) T424M probably damaging Het
Zfp735 A T 11: 73,602,677 (GRCm39) K540N possibly damaging Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137,665,969 (GRCm39) missense probably damaging 1.00
IGL01538:Ece1 APN 4 137,675,855 (GRCm39) missense probably benign
IGL01588:Ece1 APN 4 137,684,517 (GRCm39) splice site probably benign
IGL01678:Ece1 APN 4 137,690,044 (GRCm39) missense probably damaging 1.00
IGL02619:Ece1 APN 4 137,666,044 (GRCm39) missense probably benign 0.08
IGL02936:Ece1 APN 4 137,673,612 (GRCm39) missense probably benign 0.01
IGL02956:Ece1 APN 4 137,690,149 (GRCm39) missense probably damaging 0.99
IGL03332:Ece1 APN 4 137,673,666 (GRCm39) missense probably damaging 0.99
R0063:Ece1 UTSW 4 137,675,892 (GRCm39) missense probably benign 0.14
R0240:Ece1 UTSW 4 137,676,746 (GRCm39) splice site probably benign
R1004:Ece1 UTSW 4 137,653,550 (GRCm39) missense probably benign 0.04
R1515:Ece1 UTSW 4 137,678,819 (GRCm39) missense probably benign 0.00
R1541:Ece1 UTSW 4 137,675,971 (GRCm39) splice site probably null
R1796:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1834:Ece1 UTSW 4 137,685,439 (GRCm39) missense probably damaging 0.99
R1834:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1836:Ece1 UTSW 4 137,685,312 (GRCm39) missense probably damaging 1.00
R1930:Ece1 UTSW 4 137,666,074 (GRCm39) missense probably benign 0.01
R2065:Ece1 UTSW 4 137,685,393 (GRCm39) missense probably benign 0.04
R2281:Ece1 UTSW 4 137,673,673 (GRCm39) missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137,675,855 (GRCm39) missense probably benign
R4720:Ece1 UTSW 4 137,684,486 (GRCm39) missense probably damaging 1.00
R4773:Ece1 UTSW 4 137,672,464 (GRCm39) missense probably benign 0.00
R5794:Ece1 UTSW 4 137,683,844 (GRCm39) missense probably damaging 0.99
R5969:Ece1 UTSW 4 137,689,051 (GRCm39) critical splice donor site probably null
R6056:Ece1 UTSW 4 137,688,958 (GRCm39) missense probably damaging 1.00
R6332:Ece1 UTSW 4 137,685,319 (GRCm39) missense probably damaging 1.00
R6648:Ece1 UTSW 4 137,648,470 (GRCm39) missense probably benign 0.00
R7285:Ece1 UTSW 4 137,641,074 (GRCm39) splice site probably null
R7387:Ece1 UTSW 4 137,666,095 (GRCm39) missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137,641,133 (GRCm39) missense probably benign
R8294:Ece1 UTSW 4 137,675,931 (GRCm39) missense possibly damaging 0.60
R8308:Ece1 UTSW 4 137,664,075 (GRCm39) missense probably damaging 0.99
R8806:Ece1 UTSW 4 137,672,452 (GRCm39) missense probably damaging 1.00
R9578:Ece1 UTSW 4 137,641,133 (GRCm39) missense probably benign
X0063:Ece1 UTSW 4 137,653,686 (GRCm39) missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137,648,338 (GRCm39) missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CAGAGCCTTTGACTGTGTGC -3'
(R):5'- AGGTAGATCAACACCCTTCTTTATC -3'

Sequencing Primer
(F):5'- CCTTTGACTGTGTGCGCTGG -3'
(R):5'- TATCAGGTCGCTTCAAGGAC -3'
Posted On 2014-07-14