Incidental Mutation 'R1931:Tnrc18'
ID215356
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Nametrinucleotide repeat containing 18
SynonymsZfp469, EG381742
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.671) question?
Stock #R1931 (G1)
Quality Score194
Status Not validated
Chromosome5
Chromosomal Location142724661-142817662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 142776324 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 515 (N515K)
Ref Sequence ENSEMBL: ENSMUSP00000117651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
Predicted Effect unknown
Transcript: ENSMUST00000036253
AA Change: N698K
SMART Domains Protein: ENSMUSP00000040287
Gene: ENSMUSG00000039477
AA Change: N698K

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
low complexity region 820 859 N/A INTRINSIC
low complexity region 915 929 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
low complexity region 979 992 N/A INTRINSIC
low complexity region 1092 1111 N/A INTRINSIC
low complexity region 1268 1288 N/A INTRINSIC
coiled coil region 1410 1442 N/A INTRINSIC
low complexity region 1476 1492 N/A INTRINSIC
low complexity region 1580 1592 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1734 1751 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151477
AA Change: N698K
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: N698K

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: N515K
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: N515K

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
R8322:Tnrc18 UTSW 5 142726012 missense probably damaging 1.00
R8379:Tnrc18 UTSW 5 142788402 missense
RF022:Tnrc18 UTSW 5 142773630 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer
(F):5'- TGGGGACACATACGTCACTC -3'
(R):5'- AAGACCCTTAGCTGTTCCCAG -3'

Sequencing Primer
(F):5'- GAAAGACTAACTTGGTCCCAGTCTTC -3'
(R):5'- ACCAGCTGTTCCCATACT -3'
Posted On2014-07-14