Incidental Mutation 'R1931:Cav1'
ID215358
Institutional Source Beutler Lab
Gene Symbol Cav1
Ensembl Gene ENSMUSG00000007655
Gene Namecaveolin 1, caveolae protein
Synonymscaveolin-1, Cav-1
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location17306335-17341452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17339332 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 139 (I139F)
Ref Sequence ENSEMBL: ENSMUSP00000111116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007799] [ENSMUST00000115453] [ENSMUST00000115454] [ENSMUST00000115455] [ENSMUST00000115456] [ENSMUST00000123439] [ENSMUST00000177234]
Predicted Effect probably damaging
Transcript: ENSMUST00000007799
AA Change: I139F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000007799
Gene: ENSMUSG00000007655
AA Change: I139F

DomainStartEndE-ValueType
Pfam:Caveolin 27 177 4.1e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115453
AA Change: I108F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111113
Gene: ENSMUSG00000007655
AA Change: I108F

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115454
AA Change: I108F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111114
Gene: ENSMUSG00000007655
AA Change: I108F

DomainStartEndE-ValueType
Pfam:Caveolin 1 146 2e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115455
SMART Domains Protein: ENSMUSP00000111115
Gene: ENSMUSG00000007655

DomainStartEndE-ValueType
Pfam:Caveolin 16 115 2.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115456
AA Change: I139F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111116
Gene: ENSMUSG00000007655
AA Change: I139F

DomainStartEndE-ValueType
Pfam:Caveolin 42 175 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131334
Predicted Effect probably benign
Transcript: ENSMUST00000177234
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffolding protein encoded by this gene is the main component of the caveolae plasma membranes found in most cell types. The protein links integrin subunits to the tyrosine kinase FYN, an initiating step in coupling integrins to the Ras-ERK pathway and promoting cell cycle progression. The gene is a tumor suppressor gene candidate and a negative regulator of the Ras-p42/44 mitogen-activated kinase cascade. Caveolin 1 and caveolin 2 are located next to each other on chromosome 7 and express colocalizing proteins that form a stable hetero-oligomeric complex. Mutations in this gene have been associated with Berardinelli-Seip congenital lipodystrophy. Alternatively spliced transcripts encode alpha and beta isoforms of caveolin 1.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous targeted mutants displayed vascular system dysfunctions and thickening of lung aveloar septa from hyperproliferation and fibrosis, ultimately causing the mice physical limitations. Mice also display increased incidence of calcium calculi, kidney stones, and decreased adiposity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Cav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02159:Cav1 APN 6 17307972 missense possibly damaging 0.93
R0113:Cav1 UTSW 6 17308049 missense possibly damaging 0.60
R0149:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R0361:Cav1 UTSW 6 17339353 missense possibly damaging 0.46
R1706:Cav1 UTSW 6 17339182 missense probably damaging 0.96
R1930:Cav1 UTSW 6 17339332 missense probably damaging 1.00
R2166:Cav1 UTSW 6 17339431 missense possibly damaging 0.69
R2655:Cav1 UTSW 6 17339360 missense probably damaging 1.00
R4416:Cav1 UTSW 6 17339249 missense probably benign 0.36
R4460:Cav1 UTSW 6 17306472 missense probably damaging 0.99
R5204:Cav1 UTSW 6 17339255 missense probably damaging 1.00
R5956:Cav1 UTSW 6 17307919 missense probably damaging 1.00
R6467:Cav1 UTSW 6 17308035 missense probably damaging 0.99
R7041:Cav1 UTSW 6 17339144 missense possibly damaging 0.70
R8370:Cav1 UTSW 6 17339294 missense possibly damaging 0.88
X0026:Cav1 UTSW 6 17339162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGGACACACAGTTTCG -3'
(R):5'- ATAAATTTGCTGCTGCGAGAG -3'

Sequencing Primer
(F):5'- ACACAGTTTCGACGGCATCTG -3'
(R):5'- GCAACTTGGAATTGGCACC -3'
Posted On2014-07-14