Incidental Mutation 'R1931:Aak1'
ID215361
Institutional Source Beutler Lab
Gene Symbol Aak1
Ensembl Gene ENSMUSG00000057230
Gene NameAP2 associated kinase 1
Synonyms5530400K14Rik, D6Ertd245e
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location86849517-87003223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 86956336 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 430 (S430A)
Ref Sequence ENSEMBL: ENSMUSP00000086948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003710] [ENSMUST00000089519]
Predicted Effect unknown
Transcript: ENSMUST00000003710
AA Change: S430A
SMART Domains Protein: ENSMUSP00000003710
Gene: ENSMUSG00000057230
AA Change: S430A

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1.5e-27 PFAM
Pfam:Pkinase 46 312 7e-43 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 527 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 712 730 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000089519
AA Change: S430A
SMART Domains Protein: ENSMUSP00000086948
Gene: ENSMUSG00000057230
AA Change: S430A

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1e-26 PFAM
Pfam:Pkinase 46 312 2.2e-44 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 510 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 608 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 716 728 N/A INTRINSIC
low complexity region 793 811 N/A INTRINSIC
low complexity region 929 942 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204613
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor-related protein complex 2 (AP-2 complexes) functions during receptor-mediated endocytosis to trigger clathrin assembly, interact with membrane-bound receptors, and recruit encodytic accessory factors. This gene encodes a member of the SNF1 subfamily of Ser/Thr protein kinases. The protein interacts with and phosphorylates a subunit of the AP-2 complex, which promotes binding of AP-2 to sorting signals found in membrane-bound receptors and subsequent receptor endocytosis. Its kinase activity is stimulated by clathrin. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Aak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Aak1 APN 6 86946153 missense probably damaging 1.00
IGL01284:Aak1 APN 6 86850053 start codon destroyed possibly damaging 0.86
IGL01292:Aak1 APN 6 86949538 splice site probably benign
IGL01344:Aak1 APN 6 86946157 missense possibly damaging 0.49
IGL02317:Aak1 APN 6 86956300 missense possibly damaging 0.61
IGL02422:Aak1 APN 6 86982616 missense unknown
IGL02531:Aak1 APN 6 86956447 missense unknown
IGL02719:Aak1 APN 6 86959170 intron probably benign
IGL03051:Aak1 APN 6 86987301 utr 3 prime probably benign
R0382:Aak1 UTSW 6 86946919 missense probably benign 0.19
R0846:Aak1 UTSW 6 86959089 intron probably benign
R1074:Aak1 UTSW 6 86935439 missense probably damaging 0.97
R1141:Aak1 UTSW 6 86965476 critical splice acceptor site probably null
R1221:Aak1 UTSW 6 86965478 missense unknown
R1261:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1262:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1470:Aak1 UTSW 6 86967355 missense unknown
R1470:Aak1 UTSW 6 86967355 missense unknown
R3713:Aak1 UTSW 6 86955190 missense probably benign 0.19
R3785:Aak1 UTSW 6 86965578 missense unknown
R3815:Aak1 UTSW 6 86959042 intron probably benign
R3816:Aak1 UTSW 6 86959042 intron probably benign
R3819:Aak1 UTSW 6 86959042 intron probably benign
R4165:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4166:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4351:Aak1 UTSW 6 86935537 splice site probably null
R4430:Aak1 UTSW 6 86986366 missense unknown
R4431:Aak1 UTSW 6 86986318 missense unknown
R4665:Aak1 UTSW 6 86925077 missense probably null 1.00
R4821:Aak1 UTSW 6 86850189 missense probably damaging 1.00
R5088:Aak1 UTSW 6 86944480 critical splice donor site probably null
R5543:Aak1 UTSW 6 86982645 critical splice donor site probably null
R5567:Aak1 UTSW 6 86955168 nonsense probably null
R5726:Aak1 UTSW 6 86925124 nonsense probably null
R6083:Aak1 UTSW 6 86963996 missense unknown
R6269:Aak1 UTSW 6 86964051 missense unknown
R6693:Aak1 UTSW 6 86965515 missense unknown
R6700:Aak1 UTSW 6 86964203 missense unknown
R6759:Aak1 UTSW 6 86944417 missense probably damaging 1.00
R6969:Aak1 UTSW 6 86981335 missense unknown
Y4335:Aak1 UTSW 6 86959142 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCCATTTCTTGTGTAGCAAATCAC -3'
(R):5'- TGGTAAAAGGTGCCTGCAGG -3'

Sequencing Primer
(F):5'- CTCCTTCCAAGTGCTGGGATTAAAG -3'
(R):5'- CCTGCAGGCTGTGGTGG -3'
Posted On2014-07-14