Incidental Mutation 'R1931:Itpr2'
ID 215362
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Name inositol 1,4,5-triphosphate receptor 2
Synonyms Ip3r2, Itpr5
MMRRC Submission 039949-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1931 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 146009797-146403721 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 146141852 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1730 (V1730A)
Ref Sequence ENSEMBL: ENSMUSP00000078526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053273
AA Change: V1763A

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: V1763A

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079573
AA Change: V1730A

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: V1730A

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T G 6: 86,933,318 (GRCm39) S430A unknown Het
Abhd16a T A 17: 35,319,991 (GRCm39) F337L probably benign Het
Acsl1 C A 8: 46,984,023 (GRCm39) A514E probably benign Het
Adam29 T C 8: 56,326,124 (GRCm39) Y110C probably damaging Het
Adamts12 C A 15: 11,270,685 (GRCm39) Q647K probably benign Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamtsl1 A G 4: 86,260,648 (GRCm39) E961G possibly damaging Het
AW011738 T C 4: 156,287,997 (GRCm39) probably benign Het
Bcl9 T C 3: 97,112,460 (GRCm39) M1332V probably damaging Het
Birc6 T C 17: 74,872,977 (GRCm39) I412T probably damaging Het
Cav1 A T 6: 17,339,331 (GRCm39) I139F probably damaging Het
Col4a4 A C 1: 82,444,321 (GRCm39) probably null Het
Coro2a A T 4: 46,539,138 (GRCm39) *544R probably null Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Dennd2c A G 3: 103,040,568 (GRCm39) N278D probably benign Het
Dgkh T C 14: 78,853,945 (GRCm39) I265V probably damaging Het
Dpp3 A T 19: 4,967,888 (GRCm39) probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Ece1 A G 4: 137,666,074 (GRCm39) K306R probably benign Het
Eif4b T C 15: 101,997,411 (GRCm39) S309P unknown Het
Eml3 G A 19: 8,914,507 (GRCm39) V507M probably benign Het
Ezhip T C X: 5,994,817 (GRCm39) E66G probably benign Het
Fat1 C T 8: 45,497,265 (GRCm39) T4250M possibly damaging Het
Fezf1 T G 6: 23,246,906 (GRCm39) I309L probably damaging Het
Fsip2 T A 2: 82,817,077 (GRCm39) L4270H probably damaging Het
Gabra4 T C 5: 71,795,580 (GRCm39) K206E probably damaging Het
Gfm1 A G 3: 67,363,918 (GRCm39) K465E probably benign Het
Gpld1 A T 13: 25,127,693 (GRCm39) I32L possibly damaging Het
H4c12 A T 13: 21,934,682 (GRCm39) probably null Het
Hoxd12 A G 2: 74,505,857 (GRCm39) T143A probably benign Het
Hoxd12 A G 2: 74,505,875 (GRCm39) T149A probably benign Het
Hspg2 T A 4: 137,267,541 (GRCm39) S2050T probably damaging Het
Il31ra T A 13: 112,677,756 (GRCm39) N287I probably damaging Het
Itga4 G A 2: 79,144,188 (GRCm39) probably null Het
Klkb1 T A 8: 45,728,514 (GRCm39) Q415L probably benign Het
Lcn10 A G 2: 25,574,347 (GRCm39) Y118C probably damaging Het
Lgi3 T C 14: 70,773,708 (GRCm39) V294A probably damaging Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Naaa A G 5: 92,425,894 (GRCm39) V33A probably benign Het
Nckap5l A G 15: 99,325,142 (GRCm39) F454L probably damaging Het
Nol10 A G 12: 17,398,555 (GRCm39) M1V probably null Het
Olfm1 G A 2: 28,112,674 (GRCm39) probably null Het
Or2at4 G T 7: 99,385,067 (GRCm39) R239L possibly damaging Het
Or6c208 T A 10: 129,223,745 (GRCm39) M81K probably benign Het
Or7g30 T C 9: 19,352,647 (GRCm39) L146P possibly damaging Het
Osbp2 T C 11: 3,676,333 (GRCm39) probably null Het
Osbpl1a T A 18: 13,038,251 (GRCm39) Q269L probably benign Het
Papss2 T A 19: 32,616,368 (GRCm39) C191* probably null Het
Pbxip1 A T 3: 89,354,984 (GRCm39) probably null Het
Pdp1 A G 4: 11,962,074 (GRCm39) I79T probably benign Het
Peg10 A G 6: 4,755,778 (GRCm39) Y118C probably damaging Het
Pnisr A G 4: 21,873,612 (GRCm39) T452A probably benign Het
Polr2a A T 11: 69,626,201 (GRCm39) Y1612N unknown Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Prr11 A T 11: 86,996,868 (GRCm39) L32* probably null Het
Ptgfr T A 3: 151,540,831 (GRCm39) T226S probably benign Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rps6kb1 A G 11: 86,423,647 (GRCm39) V111A possibly damaging Het
Sfxn1 A T 13: 54,247,952 (GRCm39) I226F probably damaging Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc16a5 A T 11: 115,360,194 (GRCm39) I126F probably damaging Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spata3 A C 1: 85,949,783 (GRCm39) probably benign Het
St8sia6 A G 2: 13,797,623 (GRCm39) S48P probably benign Het
Stra6l A T 4: 45,882,698 (GRCm39) R470* probably null Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Sugp1 T A 8: 70,524,190 (GRCm39) D598E probably benign Het
Tekt2 T C 4: 126,216,610 (GRCm39) probably null Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmprss2 T C 16: 97,370,262 (GRCm39) S301G probably benign Het
Tnrc18 A T 5: 142,762,079 (GRCm39) N515K unknown Het
Togaram1 A G 12: 65,013,709 (GRCm39) Y320C probably damaging Het
Trim41 A G 11: 48,698,319 (GRCm39) V549A probably damaging Het
Ugt2b1 T A 5: 87,065,700 (GRCm39) L446F probably damaging Het
Unc5b T C 10: 60,608,348 (GRCm39) T621A probably benign Het
Utp25 T A 1: 192,800,617 (GRCm39) K401I probably damaging Het
Vmn1r214 C A 13: 23,219,494 (GRCm39) H329Q possibly damaging Het
Vmn2r109 T A 17: 20,774,072 (GRCm39) K428* probably null Het
Vmn2r81 A C 10: 79,129,328 (GRCm39) I740L probably damaging Het
Wdfy3 A G 5: 102,089,358 (GRCm39) L612P probably damaging Het
Zfp109 G A 7: 23,928,161 (GRCm39) T424M probably damaging Het
Zfp735 A T 11: 73,602,677 (GRCm39) K540N possibly damaging Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146,298,510 (GRCm39) missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146,292,334 (GRCm39) missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146,045,683 (GRCm39) missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146,133,934 (GRCm39) missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146,060,459 (GRCm39) missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146,212,479 (GRCm39) splice site probably benign
IGL01012:Itpr2 APN 6 146,246,659 (GRCm39) missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146,014,033 (GRCm39) nonsense probably null
IGL01411:Itpr2 APN 6 146,277,560 (GRCm39) critical splice donor site probably null
IGL01557:Itpr2 APN 6 146,060,474 (GRCm39) missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146,081,727 (GRCm39) missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146,129,079 (GRCm39) missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146,134,044 (GRCm39) missense probably benign 0.02
IGL02198:Itpr2 APN 6 146,224,725 (GRCm39) missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146,141,760 (GRCm39) splice site probably benign
IGL02332:Itpr2 APN 6 146,328,040 (GRCm39) missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146,292,819 (GRCm39) missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146,226,671 (GRCm39) missense probably benign 0.05
IGL02726:Itpr2 APN 6 146,277,419 (GRCm39) missense probably benign 0.18
IGL02851:Itpr2 APN 6 146,287,477 (GRCm39) missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146,214,402 (GRCm39) missense probably benign
IGL03015:Itpr2 APN 6 146,277,435 (GRCm39) missense probably benign
IGL03067:Itpr2 APN 6 146,226,680 (GRCm39) missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146,281,008 (GRCm39) missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146,081,742 (GRCm39) missense probably benign 0.02
IGL03275:Itpr2 APN 6 146,060,375 (GRCm39) splice site probably benign
IGL03332:Itpr2 APN 6 146,045,647 (GRCm39) missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146,058,602 (GRCm39) missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146,231,256 (GRCm39) missense probably benign
IGL03377:Itpr2 APN 6 146,231,213 (GRCm39) missense probably damaging 0.96
dollar_short UTSW 6 146,298,517 (GRCm39) nonsense probably null
enfermos UTSW 6 146,135,504 (GRCm39) missense probably damaging 0.98
Hopla UTSW 6 146,096,096 (GRCm39) missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146,280,987 (GRCm39) missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146,256,218 (GRCm39) missense probably benign
PIT4453001:Itpr2 UTSW 6 146,274,671 (GRCm39) missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146,131,369 (GRCm39) missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146,246,638 (GRCm39) missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146,246,638 (GRCm39) missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146,133,789 (GRCm39) splice site probably null
R0048:Itpr2 UTSW 6 146,133,789 (GRCm39) splice site probably null
R0055:Itpr2 UTSW 6 146,224,631 (GRCm39) missense probably benign 0.42
R0055:Itpr2 UTSW 6 146,224,631 (GRCm39) missense probably benign 0.42
R0088:Itpr2 UTSW 6 146,142,683 (GRCm39) missense probably benign
R0089:Itpr2 UTSW 6 146,251,520 (GRCm39) critical splice donor site probably null
R0114:Itpr2 UTSW 6 146,214,377 (GRCm39) missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146,141,951 (GRCm39) missense probably benign 0.00
R0144:Itpr2 UTSW 6 146,228,653 (GRCm39) missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146,403,407 (GRCm39) start gained probably benign
R0211:Itpr2 UTSW 6 146,096,111 (GRCm39) missense probably benign 0.17
R0305:Itpr2 UTSW 6 146,212,601 (GRCm39) missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146,135,506 (GRCm39) missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146,260,890 (GRCm39) missense probably benign 0.00
R0391:Itpr2 UTSW 6 146,131,271 (GRCm39) missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146,319,477 (GRCm39) missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146,277,387 (GRCm39) missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146,319,477 (GRCm39) missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146,013,898 (GRCm39) missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146,068,149 (GRCm39) missense probably benign
R0633:Itpr2 UTSW 6 146,275,954 (GRCm39) missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146,072,910 (GRCm39) missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146,251,543 (GRCm39) missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146,013,240 (GRCm39) missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146,081,788 (GRCm39) missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146,277,646 (GRCm39) missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146,251,566 (GRCm39) missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146,060,399 (GRCm39) nonsense probably null
R1796:Itpr2 UTSW 6 146,198,171 (GRCm39) missense probably benign
R1815:Itpr2 UTSW 6 146,260,914 (GRCm39) missense probably benign 0.08
R1827:Itpr2 UTSW 6 146,229,830 (GRCm39) missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146,229,830 (GRCm39) missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146,287,469 (GRCm39) missense probably benign 0.16
R1902:Itpr2 UTSW 6 146,131,201 (GRCm39) missense probably damaging 1.00
R1964:Itpr2 UTSW 6 146,013,191 (GRCm39) missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146,129,022 (GRCm39) splice site probably null
R2168:Itpr2 UTSW 6 146,013,176 (GRCm39) missense probably benign 0.05
R2179:Itpr2 UTSW 6 146,277,464 (GRCm39) missense probably benign
R2290:Itpr2 UTSW 6 146,324,326 (GRCm39) missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146,327,996 (GRCm39) missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146,072,791 (GRCm39) missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146,224,667 (GRCm39) missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146,074,839 (GRCm39) missense probably benign 0.03
R2898:Itpr2 UTSW 6 146,224,667 (GRCm39) missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146,074,839 (GRCm39) missense probably benign 0.03
R3024:Itpr2 UTSW 6 146,081,808 (GRCm39) missense probably benign 0.35
R3104:Itpr2 UTSW 6 146,214,335 (GRCm39) critical splice donor site probably null
R3607:Itpr2 UTSW 6 146,129,099 (GRCm39) missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146,284,198 (GRCm39) missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146,284,198 (GRCm39) missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146,284,198 (GRCm39) missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146,316,852 (GRCm39) missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146,133,789 (GRCm39) splice site probably null
R3821:Itpr2 UTSW 6 146,319,224 (GRCm39) missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146,275,857 (GRCm39) splice site probably null
R3958:Itpr2 UTSW 6 146,327,008 (GRCm39) missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146,327,008 (GRCm39) missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146,131,262 (GRCm39) missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146,327,008 (GRCm39) missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146,274,742 (GRCm39) splice site probably null
R4085:Itpr2 UTSW 6 146,045,746 (GRCm39) missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146,327,008 (GRCm39) missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146,327,008 (GRCm39) missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146,142,694 (GRCm39) missense probably benign 0.33
R4663:Itpr2 UTSW 6 146,274,671 (GRCm39) missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146,274,671 (GRCm39) missense probably damaging 1.00
R4684:Itpr2 UTSW 6 146,274,671 (GRCm39) missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146,131,273 (GRCm39) missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146,298,456 (GRCm39) missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146,274,671 (GRCm39) missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146,274,671 (GRCm39) missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146,274,671 (GRCm39) missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146,274,671 (GRCm39) missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146,272,829 (GRCm39) missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146,272,829 (GRCm39) missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146,226,703 (GRCm39) missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146,135,489 (GRCm39) missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146,141,840 (GRCm39) missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146,135,489 (GRCm39) missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146,045,605 (GRCm39) critical splice donor site probably null
R5224:Itpr2 UTSW 6 146,068,149 (GRCm39) missense probably benign
R5243:Itpr2 UTSW 6 146,089,044 (GRCm39) missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146,378,191 (GRCm39) missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146,277,653 (GRCm39) nonsense probably null
R5552:Itpr2 UTSW 6 146,195,578 (GRCm39) missense probably benign
R5579:Itpr2 UTSW 6 146,074,864 (GRCm39) nonsense probably null
R5744:Itpr2 UTSW 6 146,277,649 (GRCm39) missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146,045,647 (GRCm39) missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146,231,069 (GRCm39) missense probably benign 0.10
R5911:Itpr2 UTSW 6 146,214,441 (GRCm39) missense probably benign 0.42
R6044:Itpr2 UTSW 6 146,298,449 (GRCm39) missense probably null 0.98
R6072:Itpr2 UTSW 6 146,248,609 (GRCm39) missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146,229,833 (GRCm39) missense probably benign 0.01
R6483:Itpr2 UTSW 6 146,013,975 (GRCm39) missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146,231,225 (GRCm39) missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146,246,709 (GRCm39) missense probably benign 0.01
R6561:Itpr2 UTSW 6 146,135,504 (GRCm39) missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146,091,978 (GRCm39) missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146,248,669 (GRCm39) missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146,226,668 (GRCm39) missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146,287,371 (GRCm39) critical splice donor site probably null
R6831:Itpr2 UTSW 6 146,013,927 (GRCm39) missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146,298,517 (GRCm39) nonsense probably null
R7103:Itpr2 UTSW 6 146,226,572 (GRCm39) missense probably damaging 1.00
R7111:Itpr2 UTSW 6 146,226,554 (GRCm39) missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146,259,294 (GRCm39) nonsense probably null
R7165:Itpr2 UTSW 6 146,195,589 (GRCm39) missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146,212,585 (GRCm39) missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146,212,550 (GRCm39) missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146,060,447 (GRCm39) missense possibly damaging 0.95
R7342:Itpr2 UTSW 6 146,228,685 (GRCm39) missense probably damaging 0.98
R7392:Itpr2 UTSW 6 146,260,838 (GRCm39) missense possibly damaging 0.95
R7414:Itpr2 UTSW 6 146,274,706 (GRCm39) missense probably benign 0.06
R7448:Itpr2 UTSW 6 146,231,006 (GRCm39) missense probably damaging 1.00
R7492:Itpr2 UTSW 6 146,292,436 (GRCm39) missense probably damaging 1.00
R7515:Itpr2 UTSW 6 146,228,608 (GRCm39) missense probably damaging 1.00
R7529:Itpr2 UTSW 6 146,096,096 (GRCm39) missense probably damaging 0.98
R7558:Itpr2 UTSW 6 146,292,363 (GRCm39) missense probably damaging 1.00
R7650:Itpr2 UTSW 6 146,135,492 (GRCm39) missense probably benign 0.36
R7678:Itpr2 UTSW 6 146,089,048 (GRCm39) missense probably benign 0.00
R7790:Itpr2 UTSW 6 146,126,274 (GRCm39) missense probably damaging 1.00
R7798:Itpr2 UTSW 6 146,287,513 (GRCm39) missense probably benign 0.06
R7831:Itpr2 UTSW 6 146,193,082 (GRCm39) missense probably benign 0.04
R8023:Itpr2 UTSW 6 146,088,988 (GRCm39) missense probably damaging 0.97
R8046:Itpr2 UTSW 6 146,327,957 (GRCm39) missense probably damaging 0.96
R8236:Itpr2 UTSW 6 146,292,281 (GRCm39) critical splice donor site probably null
R8241:Itpr2 UTSW 6 146,320,013 (GRCm39) missense possibly damaging 0.90
R8245:Itpr2 UTSW 6 146,274,604 (GRCm39) missense probably damaging 0.98
R8324:Itpr2 UTSW 6 146,229,896 (GRCm39) missense probably damaging 0.97
R8339:Itpr2 UTSW 6 146,214,396 (GRCm39) missense probably benign 0.19
R8458:Itpr2 UTSW 6 146,135,464 (GRCm39) missense possibly damaging 0.62
R8506:Itpr2 UTSW 6 146,319,914 (GRCm39) critical splice donor site probably null
R8529:Itpr2 UTSW 6 146,231,051 (GRCm39) missense probably damaging 1.00
R8672:Itpr2 UTSW 6 146,276,016 (GRCm39) missense probably damaging 1.00
R8755:Itpr2 UTSW 6 146,133,926 (GRCm39) missense probably benign
R8816:Itpr2 UTSW 6 146,142,710 (GRCm39) missense probably damaging 0.98
R9160:Itpr2 UTSW 6 146,276,099 (GRCm39) missense probably damaging 1.00
R9273:Itpr2 UTSW 6 146,226,529 (GRCm39) missense probably damaging 1.00
R9284:Itpr2 UTSW 6 146,256,174 (GRCm39) missense probably benign 0.01
R9322:Itpr2 UTSW 6 146,226,587 (GRCm39) missense probably benign 0.19
R9357:Itpr2 UTSW 6 146,260,814 (GRCm39) missense probably damaging 1.00
R9424:Itpr2 UTSW 6 146,212,505 (GRCm39) missense probably damaging 0.98
R9438:Itpr2 UTSW 6 146,068,166 (GRCm39) missense probably benign
R9576:Itpr2 UTSW 6 146,212,505 (GRCm39) missense probably damaging 0.98
V8831:Itpr2 UTSW 6 146,287,380 (GRCm39) missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146,224,734 (GRCm39) missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146,081,851 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGGTTTCTTCAACAAGCCA -3'
(R):5'- GAGCTTGAAAACACTGTTTGCT -3'

Sequencing Primer
(F):5'- TGGTAAGTTAACCATGGTCCAGC -3'
(R):5'- TGAAAACACTGTTTGCTATTAAAAGC -3'
Posted On 2014-07-14