Incidental Mutation 'R1931:Sugp1'
ID215370
Institutional Source Beutler Lab
Gene Symbol Sugp1
Ensembl Gene ENSMUSG00000011306
Gene NameSURP and G patch domain containing 1
SynonymsSf4
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70042813-70072347 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70071540 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 598 (D598E)
Ref Sequence ENSEMBL: ENSMUSP00000011450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011450] [ENSMUST00000049197] [ENSMUST00000110160]
PDB Structure
Solution structure of SURP domain in BAB30904 [SOLUTION NMR]
Solution structure of SURP domain in splicing factor 4 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000011450
AA Change: D598E

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000011450
Gene: ENSMUSG00000011306
AA Change: D598E

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
SWAP 185 239 8e-20 SMART
SWAP 260 314 4.09e-17 SMART
low complexity region 344 365 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
G_patch 558 605 3.25e-17 SMART
low complexity region 628 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049197
SMART Domains Protein: ENSMUSP00000046114
Gene: ENSMUSG00000036151

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 64 84 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
Pfam:DUF2781 216 357 4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110160
SMART Domains Protein: ENSMUSP00000105788
Gene: ENSMUSG00000036151

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 64 84 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 171 190 N/A INTRINSIC
Pfam:DUF2781 218 357 1.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211808
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SF4 is a member of the SURP family of splicing factors.[supplied by OMIM, Sep 2003]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Sugp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02345:Sugp1 APN 8 70043084 unclassified probably benign
IGL02532:Sugp1 APN 8 70059819 missense possibly damaging 0.91
IGL02887:Sugp1 APN 8 70070126 missense probably damaging 1.00
IGL02962:Sugp1 APN 8 70059862 splice site probably benign
IGL02966:Sugp1 APN 8 70071108 unclassified probably benign
IGL03383:Sugp1 APN 8 70069567 unclassified probably benign
R0348:Sugp1 UTSW 8 70070008 missense probably damaging 1.00
R0376:Sugp1 UTSW 8 70052638 missense probably damaging 1.00
R0511:Sugp1 UTSW 8 70059363 missense probably damaging 1.00
R1930:Sugp1 UTSW 8 70071540 missense probably benign 0.05
R1933:Sugp1 UTSW 8 70056575 missense possibly damaging 0.92
R1934:Sugp1 UTSW 8 70056575 missense possibly damaging 0.92
R2391:Sugp1 UTSW 8 70059411 splice site probably null
R2484:Sugp1 UTSW 8 70069524 missense possibly damaging 0.89
R4500:Sugp1 UTSW 8 70056388 missense probably benign
R4876:Sugp1 UTSW 8 70071184 missense probably damaging 0.99
R5120:Sugp1 UTSW 8 70048667 missense probably benign 0.02
R5724:Sugp1 UTSW 8 70070149 missense probably damaging 0.98
R6736:Sugp1 UTSW 8 70059303 missense probably benign 0.44
R6967:Sugp1 UTSW 8 70060552 missense possibly damaging 0.79
R7107:Sugp1 UTSW 8 70070150 missense probably benign 0.00
R7388:Sugp1 UTSW 8 70052619 missense probably damaging 0.98
R7949:Sugp1 UTSW 8 70056503 missense possibly damaging 0.48
R8354:Sugp1 UTSW 8 70071597 nonsense probably null
R8398:Sugp1 UTSW 8 70071133 missense probably damaging 1.00
R8454:Sugp1 UTSW 8 70071597 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTAAGGTTCCAGCTAGTGAC -3'
(R):5'- CTACAGCAGGGGTTTTGTCATC -3'

Sequencing Primer
(F):5'- AGTATGTAAAGCCTTGCTACCC -3'
(R):5'- TGTCATCTCTCTCAAACTAACAGG -3'
Posted On2014-07-14