Incidental Mutation 'R1931:Osbp2'
ID215379
Institutional Source Beutler Lab
Gene Symbol Osbp2
Ensembl Gene ENSMUSG00000020435
Gene Nameoxysterol binding protein 2
SynonymsOSBPL1, 1700095P05Rik, C630001G20Rik, ORP-4
MMRRC Submission 039949-MU
Accession Numbers

Genbank: NM_152818; MGI: 1921559

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3703731-3863903 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 3726333 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070552] [ENSMUST00000101632] [ENSMUST00000102950] [ENSMUST00000127371] [ENSMUST00000155197]
Predicted Effect probably damaging
Transcript: ENSMUST00000070552
AA Change: N363D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068652
Gene: ENSMUSG00000020435
AA Change: N363D

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
PH 180 273 1.12e-16 SMART
low complexity region 281 311 N/A INTRINSIC
Blast:PH 312 394 1e-32 BLAST
low complexity region 424 437 N/A INTRINSIC
Pfam:Oxysterol_BP 519 894 3.5e-142 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000101632
SMART Domains Protein: ENSMUSP00000099156
Gene: ENSMUSG00000020435

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Oxysterol_BP 108 484 2.1e-132 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102950
SMART Domains Protein: ENSMUSP00000100015
Gene: ENSMUSG00000020435

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 66 442 2.8e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127371
AA Change: N106D

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116361
Gene: ENSMUSG00000020435
AA Change: N106D

DomainStartEndE-ValueType
low complexity region 24 39 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
Blast:PH 55 137 8e-37 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135250
Predicted Effect probably benign
Transcript: ENSMUST00000155197
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the oxysterol-binding protein-related family of proteins, which are defined by a C-terminal sterol domain with a highly conserved EQVSHHPP motif. Oxysterols are oxygenated derivatives of cholesterol that are involved in mechanisms that include apoptosis, cholesterol homeostasis, lipid trafficking and cell differentiation. This protein is selectively expressed at high levels in the brain and testis. Within the testis, the mRNA is localized to postmeiotic germ cells, including spermatids and spermatozoa, but is not detectable in somatic cells. Mice homozygous mutant for a targeted deletion in this gene do not exhibit overt developmental phenotypes but are male sterile. Females display normal fertility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with sperm defects including oligozoospermia, teratozoospermia, asthenozoospermia and abnormal spermiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Zfp735 A T 11: 73,711,851 K540N possibly damaging Het
Other mutations in Osbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Osbp2 APN 11 3711848 missense probably benign 0.02
IGL00231:Osbp2 APN 11 3726561 missense possibly damaging 0.79
IGL01023:Osbp2 APN 11 3863387 missense probably benign
IGL01819:Osbp2 APN 11 3717127 missense probably damaging 1.00
IGL01931:Osbp2 APN 11 3705388 critical splice donor site probably null
IGL01933:Osbp2 APN 11 3712016 missense probably damaging 1.00
IGL02166:Osbp2 APN 11 3717983 missense probably damaging 1.00
IGL02751:Osbp2 APN 11 3863434 missense probably benign 0.20
IGL02812:Osbp2 APN 11 3714637 missense probably benign 0.00
IGL03289:Osbp2 APN 11 3863380 missense probably benign
3-1:Osbp2 UTSW 11 3863470 missense probably benign 0.11
R0035:Osbp2 UTSW 11 3717997 splice site probably benign
R0109:Osbp2 UTSW 11 3711791 missense probably benign 0.00
R0414:Osbp2 UTSW 11 3819932 missense probably damaging 1.00
R0491:Osbp2 UTSW 11 3714709 missense probably damaging 1.00
R0791:Osbp2 UTSW 11 3711882 splice site probably benign
R1473:Osbp2 UTSW 11 3717175 splice site probably null
R1630:Osbp2 UTSW 11 3717167 missense probably benign 0.15
R2697:Osbp2 UTSW 11 3863407 missense probably benign 0.00
R3799:Osbp2 UTSW 11 3717883 missense probably damaging 1.00
R4700:Osbp2 UTSW 11 3712160 missense probably damaging 1.00
R4718:Osbp2 UTSW 11 3711793 missense probably damaging 0.98
R4788:Osbp2 UTSW 11 3863320 missense probably benign 0.44
R5381:Osbp2 UTSW 11 3705593 missense probably benign 0.12
R5615:Osbp2 UTSW 11 3863356 missense probably benign 0.00
R5681:Osbp2 UTSW 11 3863486 missense probably benign
R6171:Osbp2 UTSW 11 3717221 splice site probably null
R6329:Osbp2 UTSW 11 3715153 missense probably damaging 1.00
R6861:Osbp2 UTSW 11 3715191 missense possibly damaging 0.68
R6987:Osbp2 UTSW 11 3717958 missense probably damaging 0.99
R7205:Osbp2 UTSW 11 3712134 missense probably damaging 1.00
R7316:Osbp2 UTSW 11 3726431 missense probably damaging 1.00
R7540:Osbp2 UTSW 11 3717944 missense probably damaging 0.99
R7559:Osbp2 UTSW 11 3712493 missense probably damaging 1.00
R7830:Osbp2 UTSW 11 3863414 missense probably benign
R8085:Osbp2 UTSW 11 3712521 missense probably damaging 1.00
X0060:Osbp2 UTSW 11 3820035 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGCATGATGATAGAAACAGAATGC -3'
(R):5'- ATGATTCTGGGGACGACGAC -3'

Sequencing Primer
(F):5'- ACAGAATGCTGGTTTGTGTGGAAAG -3'
(R):5'- TGCCCCAGCTGACAACAGTG -3'
Posted On2014-07-14