Incidental Mutation 'R1931:Zfp735'
ID215382
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Namezinc finger protein 735
Synonyms1700012C15Rik
MMRRC Submission 039949-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R1931 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73688778-73713798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73711851 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 540 (K540N)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080407
AA Change: K540N

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: K540N

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149560
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik C A 5: 5,452,019 W144C probably benign Het
Aak1 T G 6: 86,956,336 S430A unknown Het
Abhd16a T A 17: 35,101,015 F337L probably benign Het
Acsl1 C A 8: 46,530,986 A514E probably benign Het
Adam29 T C 8: 55,873,089 Y110C probably damaging Het
Adamts12 C A 15: 11,270,599 Q647K probably benign Het
Adamts20 T A 15: 94,404,010 H27L probably benign Het
Adamtsl1 A G 4: 86,342,411 E961G possibly damaging Het
AU022751 T C X: 6,082,763 E66G probably benign Het
AW011738 T C 4: 156,203,540 probably benign Het
Bcl9 T C 3: 97,205,144 M1332V probably damaging Het
Birc6 T C 17: 74,565,982 I412T probably damaging Het
Cav1 A T 6: 17,339,332 I139F probably damaging Het
Col4a4 A C 1: 82,466,600 probably null Het
Coro2a A T 4: 46,539,138 *544R probably null Het
Cox15 C T 19: 43,746,785 R181H probably benign Het
Ddx23 G A 15: 98,650,718 R370W possibly damaging Het
Dennd2c A G 3: 103,133,252 N278D probably benign Het
Dgkh T C 14: 78,616,505 I265V probably damaging Het
Diexf T A 1: 193,118,309 K401I probably damaging Het
Dpp3 A T 19: 4,917,860 probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Ece1 A G 4: 137,938,763 K306R probably benign Het
Eif4b T C 15: 102,088,976 S309P unknown Het
Eml3 G A 19: 8,937,143 V507M probably benign Het
Fat1 C T 8: 45,044,228 T4250M possibly damaging Het
Fezf1 T G 6: 23,246,907 I309L probably damaging Het
Fsip2 T A 2: 82,986,733 L4270H probably damaging Het
Gabra4 T C 5: 71,638,237 K206E probably damaging Het
Gfm1 A G 3: 67,456,585 K465E probably benign Het
Gpld1 A T 13: 24,943,710 I32L possibly damaging Het
Hist1h4k A T 13: 21,750,512 probably null Het
Hoxd12 A G 2: 74,675,513 T143A probably benign Het
Hoxd12 A G 2: 74,675,531 T149A probably benign Het
Hspg2 T A 4: 137,540,230 S2050T probably damaging Het
Il31ra T A 13: 112,541,222 N287I probably damaging Het
Itga4 G A 2: 79,313,844 probably null Het
Itpr2 A G 6: 146,240,354 V1730A probably benign Het
Klkb1 T A 8: 45,275,477 Q415L probably benign Het
Lcn10 A G 2: 25,684,335 Y118C probably damaging Het
Lgi3 T C 14: 70,536,268 V294A probably damaging Het
Lrp5 C T 19: 3,610,131 V978I probably benign Het
Naaa A G 5: 92,278,035 V33A probably benign Het
Nckap5l A G 15: 99,427,261 F454L probably damaging Het
Nol10 A G 12: 17,348,554 M1V probably null Het
Olfm1 G A 2: 28,222,662 probably null Het
Olfr520 G T 7: 99,735,860 R239L possibly damaging Het
Olfr784 T A 10: 129,387,876 M81K probably benign Het
Olfr849 T C 9: 19,441,351 L146P possibly damaging Het
Osbp2 T C 11: 3,726,333 probably null Het
Osbpl1a T A 18: 12,905,194 Q269L probably benign Het
Papss2 T A 19: 32,638,968 C191* probably null Het
Pbxip1 A T 3: 89,447,677 probably null Het
Pdp1 A G 4: 11,962,074 I79T probably benign Het
Peg10 A G 6: 4,755,778 Y118C probably damaging Het
Pnisr A G 4: 21,873,612 T452A probably benign Het
Polr2a A T 11: 69,735,375 Y1612N unknown Het
Polr3c A T 3: 96,719,298 L270H probably damaging Het
Prr11 A T 11: 87,106,042 L32* probably null Het
Ptgfr T A 3: 151,835,194 T226S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rps6kb1 A G 11: 86,532,821 V111A possibly damaging Het
Sfxn1 A T 13: 54,093,933 I226F probably damaging Het
Sh3pxd2a A G 19: 47,267,508 S924P probably benign Het
Slc16a5 A T 11: 115,469,368 I126F probably damaging Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spata3 A C 1: 86,022,061 probably benign Het
St8sia6 A G 2: 13,792,812 S48P probably benign Het
Stra6l A T 4: 45,882,698 R470* probably null Het
Stradb A C 1: 58,991,105 N173H probably benign Het
Sugp1 T A 8: 70,071,540 D598E probably benign Het
Tekt2 T C 4: 126,322,817 probably null Het
Tiam2 C T 17: 3,514,725 R1413C possibly damaging Het
Tmprss2 T C 16: 97,569,062 S301G probably benign Het
Tnrc18 A T 5: 142,776,324 N515K unknown Het
Togaram1 A G 12: 64,966,935 Y320C probably damaging Het
Trim41 A G 11: 48,807,492 V549A probably damaging Het
Ugt2b1 T A 5: 86,917,841 L446F probably damaging Het
Unc5b T C 10: 60,772,569 T621A probably benign Het
Vmn1r214 C A 13: 23,035,324 H329Q possibly damaging Het
Vmn2r109 T A 17: 20,553,810 K428* probably null Het
Vmn2r81 A C 10: 79,293,494 I740L probably damaging Het
Wdfy3 A G 5: 101,941,492 L612P probably damaging Het
Zfp109 G A 7: 24,228,736 T424M probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73711366 missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73711560 missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73710479 missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73690365 missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73711428 missense probably benign 0.01
IGL02238:Zfp735 APN 11 73710493 missense probably benign 0.00
IGL02505:Zfp735 APN 11 73689800 missense probably benign 0.03
IGL02740:Zfp735 APN 11 73710586 missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73710929 missense probably benign 0.00
bescher UTSW 11 73712153 missense possibly damaging 0.93
Galvanic UTSW 11 73711678 nonsense probably null
R0114:Zfp735 UTSW 11 73710662 missense probably benign 0.33
R0217:Zfp735 UTSW 11 73711286 missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73712083 missense probably benign 0.04
R1421:Zfp735 UTSW 11 73710697 missense probably benign
R1460:Zfp735 UTSW 11 73712333 missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73710479 missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73710644 missense probably benign
R1676:Zfp735 UTSW 11 73711475 missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73711763 missense probably benign 0.01
R1871:Zfp735 UTSW 11 73710586 nonsense probably null
R2219:Zfp735 UTSW 11 73711025 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711396 missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73711397 nonsense probably null
R3552:Zfp735 UTSW 11 73711241 nonsense probably null
R3856:Zfp735 UTSW 11 73711456 missense probably benign 0.01
R3925:Zfp735 UTSW 11 73711124 missense probably benign 0.33
R4572:Zfp735 UTSW 11 73689785 missense probably benign 0.02
R4585:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73689724 missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73711205 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711855 missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73711856 missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73712113 missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73710593 nonsense probably null
R5516:Zfp735 UTSW 11 73710814 missense probably benign
R5654:Zfp735 UTSW 11 73712138 missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73690348 missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73711678 nonsense probably null
R6427:Zfp735 UTSW 11 73690314 missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73711652 missense probably benign 0.33
R6820:Zfp735 UTSW 11 73688957 start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73710608 missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73711054 missense probably benign 0.08
R6941:Zfp735 UTSW 11 73690333 missense probably benign 0.33
R7335:Zfp735 UTSW 11 73711553 missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73712153 missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73711176 missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73690328 missense possibly damaging 0.53
R7583:Zfp735 UTSW 11 73711107 missense possibly damaging 0.86
R7866:Zfp735 UTSW 11 73710803 missense probably benign 0.00
R8005:Zfp735 UTSW 11 73712314 nonsense probably null
R8500:Zfp735 UTSW 11 73710985 missense possibly damaging 0.53
R8551:Zfp735 UTSW 11 73712296 missense probably benign 0.06
R8754:Zfp735 UTSW 11 73712174 missense possibly damaging 0.85
R8769:Zfp735 UTSW 11 73690301 missense possibly damaging 0.53
R8794:Zfp735 UTSW 11 73712203 missense possibly damaging 0.66
R8835:Zfp735 UTSW 11 73710866 missense possibly damaging 0.53
R8869:Zfp735 UTSW 11 73711684 missense possibly damaging 0.53
R8969:Zfp735 UTSW 11 73711873 missense possibly damaging 0.83
R9072:Zfp735 UTSW 11 73712234 missense probably benign 0.21
Z1176:Zfp735 UTSW 11 73710815 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGAAATCATGTATGCAATGTGGC -3'
(R):5'- AATCATGTAAATGATTCCCCATGC -3'

Sequencing Primer
(F):5'- CAAGTGCTTTGCTCAGTACTCAG -3'
(R):5'- AGGACTGTGTGAATGATTTCCCAC -3'
Posted On2014-07-14