Incidental Mutation 'R1931:Zfp735'
ID 215382
Institutional Source Beutler Lab
Gene Symbol Zfp735
Ensembl Gene ENSMUSG00000060630
Gene Name zinc finger protein 735
Synonyms 1700012C15Rik
MMRRC Submission 039949-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R1931 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 73579604-73604624 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73602677 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 540 (K540N)
Ref Sequence ENSEMBL: ENSMUSP00000079269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080407]
AlphaFold B1ARH2
Predicted Effect possibly damaging
Transcript: ENSMUST00000080407
AA Change: K540N

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000079269
Gene: ENSMUSG00000060630
AA Change: K540N

DomainStartEndE-ValueType
KRAB 8 68 2.2e-34 SMART
ZnF_C2H2 483 505 4.38e1 SMART
ZnF_C2H2 511 533 2.67e-1 SMART
ZnF_C2H2 539 561 1.81e1 SMART
ZnF_C2H2 567 589 1.5e-4 SMART
ZnF_C2H2 595 617 4.87e-4 SMART
ZnF_C2H2 623 645 4.24e-4 SMART
ZnF_C2H2 651 673 2.27e-4 SMART
ZnF_C2H2 679 701 7.49e-5 SMART
ZnF_C2H2 707 729 4.87e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149560
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T G 6: 86,933,318 (GRCm39) S430A unknown Het
Abhd16a T A 17: 35,319,991 (GRCm39) F337L probably benign Het
Acsl1 C A 8: 46,984,023 (GRCm39) A514E probably benign Het
Adam29 T C 8: 56,326,124 (GRCm39) Y110C probably damaging Het
Adamts12 C A 15: 11,270,685 (GRCm39) Q647K probably benign Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamtsl1 A G 4: 86,260,648 (GRCm39) E961G possibly damaging Het
AW011738 T C 4: 156,287,997 (GRCm39) probably benign Het
Bcl9 T C 3: 97,112,460 (GRCm39) M1332V probably damaging Het
Birc6 T C 17: 74,872,977 (GRCm39) I412T probably damaging Het
Cav1 A T 6: 17,339,331 (GRCm39) I139F probably damaging Het
Col4a4 A C 1: 82,444,321 (GRCm39) probably null Het
Coro2a A T 4: 46,539,138 (GRCm39) *544R probably null Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Dennd2c A G 3: 103,040,568 (GRCm39) N278D probably benign Het
Dgkh T C 14: 78,853,945 (GRCm39) I265V probably damaging Het
Dpp3 A T 19: 4,967,888 (GRCm39) probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Ece1 A G 4: 137,666,074 (GRCm39) K306R probably benign Het
Eif4b T C 15: 101,997,411 (GRCm39) S309P unknown Het
Eml3 G A 19: 8,914,507 (GRCm39) V507M probably benign Het
Ezhip T C X: 5,994,817 (GRCm39) E66G probably benign Het
Fat1 C T 8: 45,497,265 (GRCm39) T4250M possibly damaging Het
Fezf1 T G 6: 23,246,906 (GRCm39) I309L probably damaging Het
Fsip2 T A 2: 82,817,077 (GRCm39) L4270H probably damaging Het
Gabra4 T C 5: 71,795,580 (GRCm39) K206E probably damaging Het
Gfm1 A G 3: 67,363,918 (GRCm39) K465E probably benign Het
Gpld1 A T 13: 25,127,693 (GRCm39) I32L possibly damaging Het
H4c12 A T 13: 21,934,682 (GRCm39) probably null Het
Hoxd12 A G 2: 74,505,857 (GRCm39) T143A probably benign Het
Hoxd12 A G 2: 74,505,875 (GRCm39) T149A probably benign Het
Hspg2 T A 4: 137,267,541 (GRCm39) S2050T probably damaging Het
Il31ra T A 13: 112,677,756 (GRCm39) N287I probably damaging Het
Itga4 G A 2: 79,144,188 (GRCm39) probably null Het
Itpr2 A G 6: 146,141,852 (GRCm39) V1730A probably benign Het
Klkb1 T A 8: 45,728,514 (GRCm39) Q415L probably benign Het
Lcn10 A G 2: 25,574,347 (GRCm39) Y118C probably damaging Het
Lgi3 T C 14: 70,773,708 (GRCm39) V294A probably damaging Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Naaa A G 5: 92,425,894 (GRCm39) V33A probably benign Het
Nckap5l A G 15: 99,325,142 (GRCm39) F454L probably damaging Het
Nol10 A G 12: 17,398,555 (GRCm39) M1V probably null Het
Olfm1 G A 2: 28,112,674 (GRCm39) probably null Het
Or2at4 G T 7: 99,385,067 (GRCm39) R239L possibly damaging Het
Or6c208 T A 10: 129,223,745 (GRCm39) M81K probably benign Het
Or7g30 T C 9: 19,352,647 (GRCm39) L146P possibly damaging Het
Osbp2 T C 11: 3,676,333 (GRCm39) probably null Het
Osbpl1a T A 18: 13,038,251 (GRCm39) Q269L probably benign Het
Papss2 T A 19: 32,616,368 (GRCm39) C191* probably null Het
Pbxip1 A T 3: 89,354,984 (GRCm39) probably null Het
Pdp1 A G 4: 11,962,074 (GRCm39) I79T probably benign Het
Peg10 A G 6: 4,755,778 (GRCm39) Y118C probably damaging Het
Pnisr A G 4: 21,873,612 (GRCm39) T452A probably benign Het
Polr2a A T 11: 69,626,201 (GRCm39) Y1612N unknown Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Prr11 A T 11: 86,996,868 (GRCm39) L32* probably null Het
Ptgfr T A 3: 151,540,831 (GRCm39) T226S probably benign Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rps6kb1 A G 11: 86,423,647 (GRCm39) V111A possibly damaging Het
Sfxn1 A T 13: 54,247,952 (GRCm39) I226F probably damaging Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc16a5 A T 11: 115,360,194 (GRCm39) I126F probably damaging Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spata3 A C 1: 85,949,783 (GRCm39) probably benign Het
St8sia6 A G 2: 13,797,623 (GRCm39) S48P probably benign Het
Stra6l A T 4: 45,882,698 (GRCm39) R470* probably null Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Sugp1 T A 8: 70,524,190 (GRCm39) D598E probably benign Het
Tekt2 T C 4: 126,216,610 (GRCm39) probably null Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmprss2 T C 16: 97,370,262 (GRCm39) S301G probably benign Het
Tnrc18 A T 5: 142,762,079 (GRCm39) N515K unknown Het
Togaram1 A G 12: 65,013,709 (GRCm39) Y320C probably damaging Het
Trim41 A G 11: 48,698,319 (GRCm39) V549A probably damaging Het
Ugt2b1 T A 5: 87,065,700 (GRCm39) L446F probably damaging Het
Unc5b T C 10: 60,608,348 (GRCm39) T621A probably benign Het
Utp25 T A 1: 192,800,617 (GRCm39) K401I probably damaging Het
Vmn1r214 C A 13: 23,219,494 (GRCm39) H329Q possibly damaging Het
Vmn2r109 T A 17: 20,774,072 (GRCm39) K428* probably null Het
Vmn2r81 A C 10: 79,129,328 (GRCm39) I740L probably damaging Het
Wdfy3 A G 5: 102,089,358 (GRCm39) L612P probably damaging Het
Zfp109 G A 7: 23,928,161 (GRCm39) T424M probably damaging Het
Other mutations in Zfp735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Zfp735 APN 11 73,602,192 (GRCm39) missense possibly damaging 0.86
IGL00798:Zfp735 APN 11 73,602,386 (GRCm39) missense possibly damaging 0.72
IGL01642:Zfp735 APN 11 73,601,305 (GRCm39) missense possibly damaging 0.73
IGL01684:Zfp735 APN 11 73,581,191 (GRCm39) missense possibly damaging 0.86
IGL02096:Zfp735 APN 11 73,602,254 (GRCm39) missense probably benign 0.01
IGL02238:Zfp735 APN 11 73,601,319 (GRCm39) missense probably benign 0.00
IGL02505:Zfp735 APN 11 73,580,626 (GRCm39) missense probably benign 0.03
IGL02740:Zfp735 APN 11 73,601,412 (GRCm39) missense possibly damaging 0.53
IGL02957:Zfp735 APN 11 73,601,755 (GRCm39) missense probably benign 0.00
bananaquit UTSW 11 73,601,412 (GRCm39) nonsense probably null
bescher UTSW 11 73,602,979 (GRCm39) missense possibly damaging 0.93
Galvanic UTSW 11 73,602,504 (GRCm39) nonsense probably null
grassquit UTSW 11 73,603,029 (GRCm39) missense possibly damaging 0.66
R0114:Zfp735 UTSW 11 73,601,488 (GRCm39) missense probably benign 0.33
R0217:Zfp735 UTSW 11 73,602,112 (GRCm39) missense possibly damaging 0.73
R0943:Zfp735 UTSW 11 73,602,909 (GRCm39) missense probably benign 0.04
R1421:Zfp735 UTSW 11 73,601,523 (GRCm39) missense probably benign
R1460:Zfp735 UTSW 11 73,603,159 (GRCm39) missense possibly damaging 0.73
R1493:Zfp735 UTSW 11 73,601,305 (GRCm39) missense possibly damaging 0.73
R1517:Zfp735 UTSW 11 73,601,470 (GRCm39) missense probably benign
R1676:Zfp735 UTSW 11 73,602,301 (GRCm39) missense possibly damaging 0.53
R1709:Zfp735 UTSW 11 73,602,589 (GRCm39) missense probably benign 0.01
R1871:Zfp735 UTSW 11 73,601,412 (GRCm39) nonsense probably null
R2219:Zfp735 UTSW 11 73,601,851 (GRCm39) missense possibly damaging 0.53
R2227:Zfp735 UTSW 11 73,602,223 (GRCm39) nonsense probably null
R2227:Zfp735 UTSW 11 73,602,222 (GRCm39) missense possibly damaging 0.53
R3552:Zfp735 UTSW 11 73,602,067 (GRCm39) nonsense probably null
R3856:Zfp735 UTSW 11 73,602,282 (GRCm39) missense probably benign 0.01
R3925:Zfp735 UTSW 11 73,601,950 (GRCm39) missense probably benign 0.33
R4572:Zfp735 UTSW 11 73,580,611 (GRCm39) missense probably benign 0.02
R4585:Zfp735 UTSW 11 73,580,550 (GRCm39) missense possibly damaging 0.51
R4586:Zfp735 UTSW 11 73,580,550 (GRCm39) missense possibly damaging 0.51
R4619:Zfp735 UTSW 11 73,602,031 (GRCm39) missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73,602,682 (GRCm39) missense probably damaging 0.98
R4687:Zfp735 UTSW 11 73,602,681 (GRCm39) missense probably damaging 0.98
R5435:Zfp735 UTSW 11 73,602,939 (GRCm39) missense possibly damaging 0.72
R5489:Zfp735 UTSW 11 73,601,419 (GRCm39) nonsense probably null
R5516:Zfp735 UTSW 11 73,601,640 (GRCm39) missense probably benign
R5654:Zfp735 UTSW 11 73,602,964 (GRCm39) missense possibly damaging 0.71
R5990:Zfp735 UTSW 11 73,581,174 (GRCm39) missense possibly damaging 0.70
R6332:Zfp735 UTSW 11 73,602,504 (GRCm39) nonsense probably null
R6427:Zfp735 UTSW 11 73,581,140 (GRCm39) missense possibly damaging 0.73
R6460:Zfp735 UTSW 11 73,602,478 (GRCm39) missense probably benign 0.33
R6820:Zfp735 UTSW 11 73,579,783 (GRCm39) start codon destroyed probably null 0.01
R6831:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6833:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6834:Zfp735 UTSW 11 73,601,434 (GRCm39) missense probably damaging 1.00
R6897:Zfp735 UTSW 11 73,601,880 (GRCm39) missense probably benign 0.08
R6941:Zfp735 UTSW 11 73,581,159 (GRCm39) missense probably benign 0.33
R7335:Zfp735 UTSW 11 73,602,379 (GRCm39) missense possibly damaging 0.47
R7366:Zfp735 UTSW 11 73,602,979 (GRCm39) missense possibly damaging 0.93
R7474:Zfp735 UTSW 11 73,602,002 (GRCm39) missense possibly damaging 0.72
R7487:Zfp735 UTSW 11 73,581,154 (GRCm39) missense possibly damaging 0.53
R7583:Zfp735 UTSW 11 73,601,933 (GRCm39) missense possibly damaging 0.86
R7866:Zfp735 UTSW 11 73,601,629 (GRCm39) missense probably benign 0.00
R8005:Zfp735 UTSW 11 73,603,140 (GRCm39) nonsense probably null
R8500:Zfp735 UTSW 11 73,601,811 (GRCm39) missense possibly damaging 0.53
R8551:Zfp735 UTSW 11 73,603,122 (GRCm39) missense probably benign 0.06
R8754:Zfp735 UTSW 11 73,603,000 (GRCm39) missense possibly damaging 0.85
R8769:Zfp735 UTSW 11 73,581,127 (GRCm39) missense possibly damaging 0.53
R8794:Zfp735 UTSW 11 73,603,029 (GRCm39) missense possibly damaging 0.66
R8835:Zfp735 UTSW 11 73,601,692 (GRCm39) missense possibly damaging 0.53
R8869:Zfp735 UTSW 11 73,602,510 (GRCm39) missense possibly damaging 0.53
R8969:Zfp735 UTSW 11 73,602,699 (GRCm39) missense possibly damaging 0.83
R9072:Zfp735 UTSW 11 73,603,060 (GRCm39) missense probably benign 0.21
R9073:Zfp735 UTSW 11 73,603,060 (GRCm39) missense probably benign 0.21
R9193:Zfp735 UTSW 11 73,580,600 (GRCm39) missense possibly damaging 0.71
R9355:Zfp735 UTSW 11 73,602,362 (GRCm39) missense probably benign 0.01
R9414:Zfp735 UTSW 11 73,602,023 (GRCm39) nonsense probably null
R9456:Zfp735 UTSW 11 73,602,403 (GRCm39) missense possibly damaging 0.53
R9573:Zfp735 UTSW 11 73,602,936 (GRCm39) missense possibly damaging 0.67
R9647:Zfp735 UTSW 11 73,580,600 (GRCm39) missense probably damaging 0.98
R9710:Zfp735 UTSW 11 73,601,806 (GRCm39) missense possibly damaging 0.86
Z1176:Zfp735 UTSW 11 73,601,641 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGAAATCATGTATGCAATGTGGC -3'
(R):5'- AATCATGTAAATGATTCCCCATGC -3'

Sequencing Primer
(F):5'- CAAGTGCTTTGCTCAGTACTCAG -3'
(R):5'- AGGACTGTGTGAATGATTTCCCAC -3'
Posted On 2014-07-14