Incidental Mutation 'R1931:Togaram1'
ID 215387
Institutional Source Beutler Lab
Gene Symbol Togaram1
Ensembl Gene ENSMUSG00000035614
Gene Name TOG array regulator of axonemal microtubules 1
Synonyms A430041B07Rik, Fam179b
MMRRC Submission 039949-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.874) question?
Stock # R1931 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 65012578-65069347 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65013709 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 320 (Y320C)
Ref Sequence ENSEMBL: ENSMUSP00000152616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021331] [ENSMUST00000066296] [ENSMUST00000222508] [ENSMUST00000223166]
AlphaFold Q6A070
Predicted Effect probably benign
Transcript: ENSMUST00000021331
SMART Domains Protein: ENSMUSP00000021331
Gene: ENSMUSG00000020948

DomainStartEndE-ValueType
BTB 35 132 3.55e-30 SMART
BACK 137 239 1.83e-36 SMART
Kelch 284 331 3.52e-4 SMART
Kelch 332 386 4.23e-7 SMART
Kelch 387 433 1.99e-12 SMART
Kelch 434 479 1.64e-13 SMART
Kelch 480 526 5.12e-15 SMART
Kelch 527 571 5.29e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066296
AA Change: Y320C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070382
Gene: ENSMUSG00000035614
AA Change: Y320C

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
TOG 339 574 3.38e-23 SMART
low complexity region 804 815 N/A INTRINSIC
low complexity region 988 1001 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1033 1041 N/A INTRINSIC
coiled coil region 1177 1206 N/A INTRINSIC
TOG 1251 1486 4.37e-8 SMART
TOG 1533 1776 1.53e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221836
AA Change: Y293C
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221957
Predicted Effect probably benign
Transcript: ENSMUST00000222508
Predicted Effect probably damaging
Transcript: ENSMUST00000223166
AA Change: Y320C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T G 6: 86,933,318 (GRCm39) S430A unknown Het
Abhd16a T A 17: 35,319,991 (GRCm39) F337L probably benign Het
Acsl1 C A 8: 46,984,023 (GRCm39) A514E probably benign Het
Adam29 T C 8: 56,326,124 (GRCm39) Y110C probably damaging Het
Adamts12 C A 15: 11,270,685 (GRCm39) Q647K probably benign Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamtsl1 A G 4: 86,260,648 (GRCm39) E961G possibly damaging Het
AW011738 T C 4: 156,287,997 (GRCm39) probably benign Het
Bcl9 T C 3: 97,112,460 (GRCm39) M1332V probably damaging Het
Birc6 T C 17: 74,872,977 (GRCm39) I412T probably damaging Het
Cav1 A T 6: 17,339,331 (GRCm39) I139F probably damaging Het
Col4a4 A C 1: 82,444,321 (GRCm39) probably null Het
Coro2a A T 4: 46,539,138 (GRCm39) *544R probably null Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Dennd2c A G 3: 103,040,568 (GRCm39) N278D probably benign Het
Dgkh T C 14: 78,853,945 (GRCm39) I265V probably damaging Het
Dpp3 A T 19: 4,967,888 (GRCm39) probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Ece1 A G 4: 137,666,074 (GRCm39) K306R probably benign Het
Eif4b T C 15: 101,997,411 (GRCm39) S309P unknown Het
Eml3 G A 19: 8,914,507 (GRCm39) V507M probably benign Het
Ezhip T C X: 5,994,817 (GRCm39) E66G probably benign Het
Fat1 C T 8: 45,497,265 (GRCm39) T4250M possibly damaging Het
Fezf1 T G 6: 23,246,906 (GRCm39) I309L probably damaging Het
Fsip2 T A 2: 82,817,077 (GRCm39) L4270H probably damaging Het
Gabra4 T C 5: 71,795,580 (GRCm39) K206E probably damaging Het
Gfm1 A G 3: 67,363,918 (GRCm39) K465E probably benign Het
Gpld1 A T 13: 25,127,693 (GRCm39) I32L possibly damaging Het
H4c12 A T 13: 21,934,682 (GRCm39) probably null Het
Hoxd12 A G 2: 74,505,857 (GRCm39) T143A probably benign Het
Hoxd12 A G 2: 74,505,875 (GRCm39) T149A probably benign Het
Hspg2 T A 4: 137,267,541 (GRCm39) S2050T probably damaging Het
Il31ra T A 13: 112,677,756 (GRCm39) N287I probably damaging Het
Itga4 G A 2: 79,144,188 (GRCm39) probably null Het
Itpr2 A G 6: 146,141,852 (GRCm39) V1730A probably benign Het
Klkb1 T A 8: 45,728,514 (GRCm39) Q415L probably benign Het
Lcn10 A G 2: 25,574,347 (GRCm39) Y118C probably damaging Het
Lgi3 T C 14: 70,773,708 (GRCm39) V294A probably damaging Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Naaa A G 5: 92,425,894 (GRCm39) V33A probably benign Het
Nckap5l A G 15: 99,325,142 (GRCm39) F454L probably damaging Het
Nol10 A G 12: 17,398,555 (GRCm39) M1V probably null Het
Olfm1 G A 2: 28,112,674 (GRCm39) probably null Het
Or2at4 G T 7: 99,385,067 (GRCm39) R239L possibly damaging Het
Or6c208 T A 10: 129,223,745 (GRCm39) M81K probably benign Het
Or7g30 T C 9: 19,352,647 (GRCm39) L146P possibly damaging Het
Osbp2 T C 11: 3,676,333 (GRCm39) probably null Het
Osbpl1a T A 18: 13,038,251 (GRCm39) Q269L probably benign Het
Papss2 T A 19: 32,616,368 (GRCm39) C191* probably null Het
Pbxip1 A T 3: 89,354,984 (GRCm39) probably null Het
Pdp1 A G 4: 11,962,074 (GRCm39) I79T probably benign Het
Peg10 A G 6: 4,755,778 (GRCm39) Y118C probably damaging Het
Pnisr A G 4: 21,873,612 (GRCm39) T452A probably benign Het
Polr2a A T 11: 69,626,201 (GRCm39) Y1612N unknown Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Prr11 A T 11: 86,996,868 (GRCm39) L32* probably null Het
Ptgfr T A 3: 151,540,831 (GRCm39) T226S probably benign Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rps6kb1 A G 11: 86,423,647 (GRCm39) V111A possibly damaging Het
Sfxn1 A T 13: 54,247,952 (GRCm39) I226F probably damaging Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc16a5 A T 11: 115,360,194 (GRCm39) I126F probably damaging Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spata3 A C 1: 85,949,783 (GRCm39) probably benign Het
St8sia6 A G 2: 13,797,623 (GRCm39) S48P probably benign Het
Stra6l A T 4: 45,882,698 (GRCm39) R470* probably null Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Sugp1 T A 8: 70,524,190 (GRCm39) D598E probably benign Het
Tekt2 T C 4: 126,216,610 (GRCm39) probably null Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmprss2 T C 16: 97,370,262 (GRCm39) S301G probably benign Het
Tnrc18 A T 5: 142,762,079 (GRCm39) N515K unknown Het
Trim41 A G 11: 48,698,319 (GRCm39) V549A probably damaging Het
Ugt2b1 T A 5: 87,065,700 (GRCm39) L446F probably damaging Het
Unc5b T C 10: 60,608,348 (GRCm39) T621A probably benign Het
Utp25 T A 1: 192,800,617 (GRCm39) K401I probably damaging Het
Vmn1r214 C A 13: 23,219,494 (GRCm39) H329Q possibly damaging Het
Vmn2r109 T A 17: 20,774,072 (GRCm39) K428* probably null Het
Vmn2r81 A C 10: 79,129,328 (GRCm39) I740L probably damaging Het
Wdfy3 A G 5: 102,089,358 (GRCm39) L612P probably damaging Het
Zfp109 G A 7: 23,928,161 (GRCm39) T424M probably damaging Het
Zfp735 A T 11: 73,602,677 (GRCm39) K540N possibly damaging Het
Other mutations in Togaram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Togaram1 APN 12 65,053,173 (GRCm39) missense probably damaging 1.00
IGL01128:Togaram1 APN 12 65,027,650 (GRCm39) missense probably benign 0.01
IGL01406:Togaram1 APN 12 65,042,352 (GRCm39) missense possibly damaging 0.81
IGL01534:Togaram1 APN 12 65,013,321 (GRCm39) missense probably damaging 0.99
IGL01569:Togaram1 APN 12 65,029,436 (GRCm39) missense possibly damaging 0.81
IGL01927:Togaram1 APN 12 65,023,476 (GRCm39) missense probably benign 0.31
IGL02066:Togaram1 APN 12 65,030,195 (GRCm39) missense probably damaging 1.00
IGL02746:Togaram1 APN 12 65,013,270 (GRCm39) nonsense probably null
IGL02878:Togaram1 APN 12 65,039,400 (GRCm39) missense possibly damaging 0.60
IGL02947:Togaram1 APN 12 65,068,274 (GRCm39) missense probably damaging 1.00
IGL02961:Togaram1 APN 12 65,013,484 (GRCm39) missense probably damaging 1.00
PIT4810001:Togaram1 UTSW 12 65,030,286 (GRCm39) missense probably damaging 1.00
R0483:Togaram1 UTSW 12 65,053,805 (GRCm39) missense probably damaging 1.00
R0519:Togaram1 UTSW 12 65,012,776 (GRCm39) unclassified probably benign
R0584:Togaram1 UTSW 12 65,014,279 (GRCm39) missense probably damaging 1.00
R0646:Togaram1 UTSW 12 65,068,240 (GRCm39) missense probably damaging 1.00
R0749:Togaram1 UTSW 12 65,029,472 (GRCm39) missense possibly damaging 0.87
R0891:Togaram1 UTSW 12 65,029,421 (GRCm39) missense probably benign 0.01
R1111:Togaram1 UTSW 12 65,053,115 (GRCm39) missense probably damaging 1.00
R1349:Togaram1 UTSW 12 65,057,919 (GRCm39) missense probably damaging 0.99
R1531:Togaram1 UTSW 12 65,013,039 (GRCm39) missense probably benign 0.01
R1618:Togaram1 UTSW 12 65,013,847 (GRCm39) missense possibly damaging 0.47
R1672:Togaram1 UTSW 12 65,068,342 (GRCm39) missense probably benign 0.00
R1789:Togaram1 UTSW 12 65,049,409 (GRCm39) missense possibly damaging 0.47
R1822:Togaram1 UTSW 12 65,042,409 (GRCm39) missense probably damaging 0.98
R1930:Togaram1 UTSW 12 65,013,709 (GRCm39) missense probably damaging 1.00
R2006:Togaram1 UTSW 12 65,065,914 (GRCm39) missense probably damaging 1.00
R2018:Togaram1 UTSW 12 65,049,433 (GRCm39) missense possibly damaging 0.76
R2304:Togaram1 UTSW 12 65,023,630 (GRCm39) splice site probably null
R2345:Togaram1 UTSW 12 65,055,406 (GRCm39) missense probably benign 0.05
R2407:Togaram1 UTSW 12 65,014,444 (GRCm39) missense probably damaging 1.00
R2853:Togaram1 UTSW 12 65,063,386 (GRCm39) missense probably benign 0.40
R3123:Togaram1 UTSW 12 65,013,118 (GRCm39) missense probably damaging 1.00
R3124:Togaram1 UTSW 12 65,013,118 (GRCm39) missense probably damaging 1.00
R3125:Togaram1 UTSW 12 65,013,118 (GRCm39) missense probably damaging 1.00
R3693:Togaram1 UTSW 12 65,030,283 (GRCm39) missense probably benign 0.34
R3857:Togaram1 UTSW 12 65,027,633 (GRCm39) missense possibly damaging 0.64
R3870:Togaram1 UTSW 12 65,049,419 (GRCm39) missense probably benign 0.00
R3871:Togaram1 UTSW 12 65,049,419 (GRCm39) missense probably benign 0.00
R4398:Togaram1 UTSW 12 65,027,630 (GRCm39) missense probably benign
R4578:Togaram1 UTSW 12 65,067,100 (GRCm39) missense probably damaging 1.00
R4579:Togaram1 UTSW 12 65,014,681 (GRCm39) missense probably damaging 1.00
R4621:Togaram1 UTSW 12 65,029,224 (GRCm39) missense possibly damaging 0.87
R4623:Togaram1 UTSW 12 65,029,224 (GRCm39) missense possibly damaging 0.87
R4655:Togaram1 UTSW 12 65,013,894 (GRCm39) missense possibly damaging 0.91
R5080:Togaram1 UTSW 12 65,030,177 (GRCm39) missense probably benign 0.02
R5459:Togaram1 UTSW 12 65,014,510 (GRCm39) missense probably damaging 1.00
R5652:Togaram1 UTSW 12 65,063,424 (GRCm39) missense probably benign 0.13
R5857:Togaram1 UTSW 12 65,042,331 (GRCm39) missense possibly damaging 0.64
R5997:Togaram1 UTSW 12 65,042,312 (GRCm39) missense probably benign 0.00
R6090:Togaram1 UTSW 12 65,014,575 (GRCm39) missense probably benign 0.07
R6117:Togaram1 UTSW 12 65,014,261 (GRCm39) missense probably damaging 1.00
R6221:Togaram1 UTSW 12 65,013,320 (GRCm39) missense probably damaging 1.00
R6505:Togaram1 UTSW 12 65,013,364 (GRCm39) missense possibly damaging 0.78
R6545:Togaram1 UTSW 12 65,024,981 (GRCm39) missense possibly damaging 0.90
R6706:Togaram1 UTSW 12 65,049,383 (GRCm39) missense probably benign 0.16
R7041:Togaram1 UTSW 12 65,067,160 (GRCm39) missense possibly damaging 0.76
R7199:Togaram1 UTSW 12 65,042,292 (GRCm39) missense probably benign
R7284:Togaram1 UTSW 12 65,055,454 (GRCm39) missense probably benign 0.09
R7451:Togaram1 UTSW 12 65,043,749 (GRCm39) missense probably damaging 1.00
R7504:Togaram1 UTSW 12 65,039,391 (GRCm39) missense possibly damaging 0.79
R7560:Togaram1 UTSW 12 65,057,916 (GRCm39) missense possibly damaging 0.52
R7802:Togaram1 UTSW 12 65,013,758 (GRCm39) nonsense probably null
R7842:Togaram1 UTSW 12 65,013,233 (GRCm39) missense probably damaging 1.00
R7922:Togaram1 UTSW 12 65,014,512 (GRCm39) missense probably damaging 1.00
R8174:Togaram1 UTSW 12 65,029,465 (GRCm39) missense possibly damaging 0.86
R8190:Togaram1 UTSW 12 65,053,686 (GRCm39) missense probably damaging 1.00
R8264:Togaram1 UTSW 12 65,042,330 (GRCm39) missense probably benign 0.00
R8466:Togaram1 UTSW 12 65,033,216 (GRCm39) missense probably benign 0.00
R8523:Togaram1 UTSW 12 65,067,088 (GRCm39) missense probably damaging 1.00
R8861:Togaram1 UTSW 12 65,027,406 (GRCm39) missense possibly damaging 0.88
R9213:Togaram1 UTSW 12 65,065,906 (GRCm39) missense possibly damaging 0.60
R9381:Togaram1 UTSW 12 65,014,204 (GRCm39) missense probably damaging 1.00
R9396:Togaram1 UTSW 12 65,014,429 (GRCm39) missense probably damaging 0.99
R9645:Togaram1 UTSW 12 65,066,082 (GRCm39) nonsense probably null
R9784:Togaram1 UTSW 12 65,014,168 (GRCm39) nonsense probably null
X0021:Togaram1 UTSW 12 65,012,958 (GRCm39) missense probably benign 0.00
Z1177:Togaram1 UTSW 12 65,012,982 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TAATATCTCTGGCCCGAAAGC -3'
(R):5'- AGCATGAGGGGTCGAACTTG -3'

Sequencing Primer
(F):5'- CCGAAAGCTTGGCGATCAG -3'
(R):5'- GGGTTAAATTTTCCCAGCAACTGC -3'
Posted On 2014-07-14