Incidental Mutation 'R1931:Gpld1'
ID 215390
Institutional Source Beutler Lab
Gene Symbol Gpld1
Ensembl Gene ENSMUSG00000021340
Gene Name glycosylphosphatidylinositol specific phospholipase D1
Synonyms 6330541J12Rik
MMRRC Submission 039949-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1931 (G1)
Quality Score 181
Status Not validated
Chromosome 13
Chromosomal Location 25127135-25175919 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25127693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 32 (I32L)
Ref Sequence ENSEMBL: ENSMUSP00000021773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021773]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000021773
AA Change: I32L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: I32L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zn_dep_PLPC 28 219 9.8e-28 PFAM
Int_alpha 377 435 7.21e-11 SMART
Int_alpha 446 503 7.43e-13 SMART
Int_alpha 509 565 7.86e-3 SMART
Int_alpha 576 643 4.09e0 SMART
Blast:Int_alpha 644 708 2e-24 BLAST
Int_alpha 716 774 1.86e-4 SMART
Blast:Int_alpha 789 837 1e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154919
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T G 6: 86,933,318 (GRCm39) S430A unknown Het
Abhd16a T A 17: 35,319,991 (GRCm39) F337L probably benign Het
Acsl1 C A 8: 46,984,023 (GRCm39) A514E probably benign Het
Adam29 T C 8: 56,326,124 (GRCm39) Y110C probably damaging Het
Adamts12 C A 15: 11,270,685 (GRCm39) Q647K probably benign Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamtsl1 A G 4: 86,260,648 (GRCm39) E961G possibly damaging Het
AW011738 T C 4: 156,287,997 (GRCm39) probably benign Het
Bcl9 T C 3: 97,112,460 (GRCm39) M1332V probably damaging Het
Birc6 T C 17: 74,872,977 (GRCm39) I412T probably damaging Het
Cav1 A T 6: 17,339,331 (GRCm39) I139F probably damaging Het
Col4a4 A C 1: 82,444,321 (GRCm39) probably null Het
Coro2a A T 4: 46,539,138 (GRCm39) *544R probably null Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Dennd2c A G 3: 103,040,568 (GRCm39) N278D probably benign Het
Dgkh T C 14: 78,853,945 (GRCm39) I265V probably damaging Het
Dpp3 A T 19: 4,967,888 (GRCm39) probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Ece1 A G 4: 137,666,074 (GRCm39) K306R probably benign Het
Eif4b T C 15: 101,997,411 (GRCm39) S309P unknown Het
Eml3 G A 19: 8,914,507 (GRCm39) V507M probably benign Het
Ezhip T C X: 5,994,817 (GRCm39) E66G probably benign Het
Fat1 C T 8: 45,497,265 (GRCm39) T4250M possibly damaging Het
Fezf1 T G 6: 23,246,906 (GRCm39) I309L probably damaging Het
Fsip2 T A 2: 82,817,077 (GRCm39) L4270H probably damaging Het
Gabra4 T C 5: 71,795,580 (GRCm39) K206E probably damaging Het
Gfm1 A G 3: 67,363,918 (GRCm39) K465E probably benign Het
H4c12 A T 13: 21,934,682 (GRCm39) probably null Het
Hoxd12 A G 2: 74,505,857 (GRCm39) T143A probably benign Het
Hoxd12 A G 2: 74,505,875 (GRCm39) T149A probably benign Het
Hspg2 T A 4: 137,267,541 (GRCm39) S2050T probably damaging Het
Il31ra T A 13: 112,677,756 (GRCm39) N287I probably damaging Het
Itga4 G A 2: 79,144,188 (GRCm39) probably null Het
Itpr2 A G 6: 146,141,852 (GRCm39) V1730A probably benign Het
Klkb1 T A 8: 45,728,514 (GRCm39) Q415L probably benign Het
Lcn10 A G 2: 25,574,347 (GRCm39) Y118C probably damaging Het
Lgi3 T C 14: 70,773,708 (GRCm39) V294A probably damaging Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Naaa A G 5: 92,425,894 (GRCm39) V33A probably benign Het
Nckap5l A G 15: 99,325,142 (GRCm39) F454L probably damaging Het
Nol10 A G 12: 17,398,555 (GRCm39) M1V probably null Het
Olfm1 G A 2: 28,112,674 (GRCm39) probably null Het
Or2at4 G T 7: 99,385,067 (GRCm39) R239L possibly damaging Het
Or6c208 T A 10: 129,223,745 (GRCm39) M81K probably benign Het
Or7g30 T C 9: 19,352,647 (GRCm39) L146P possibly damaging Het
Osbp2 T C 11: 3,676,333 (GRCm39) probably null Het
Osbpl1a T A 18: 13,038,251 (GRCm39) Q269L probably benign Het
Papss2 T A 19: 32,616,368 (GRCm39) C191* probably null Het
Pbxip1 A T 3: 89,354,984 (GRCm39) probably null Het
Pdp1 A G 4: 11,962,074 (GRCm39) I79T probably benign Het
Peg10 A G 6: 4,755,778 (GRCm39) Y118C probably damaging Het
Pnisr A G 4: 21,873,612 (GRCm39) T452A probably benign Het
Polr2a A T 11: 69,626,201 (GRCm39) Y1612N unknown Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Prr11 A T 11: 86,996,868 (GRCm39) L32* probably null Het
Ptgfr T A 3: 151,540,831 (GRCm39) T226S probably benign Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rps6kb1 A G 11: 86,423,647 (GRCm39) V111A possibly damaging Het
Sfxn1 A T 13: 54,247,952 (GRCm39) I226F probably damaging Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc16a5 A T 11: 115,360,194 (GRCm39) I126F probably damaging Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spata3 A C 1: 85,949,783 (GRCm39) probably benign Het
St8sia6 A G 2: 13,797,623 (GRCm39) S48P probably benign Het
Stra6l A T 4: 45,882,698 (GRCm39) R470* probably null Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Sugp1 T A 8: 70,524,190 (GRCm39) D598E probably benign Het
Tekt2 T C 4: 126,216,610 (GRCm39) probably null Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmprss2 T C 16: 97,370,262 (GRCm39) S301G probably benign Het
Tnrc18 A T 5: 142,762,079 (GRCm39) N515K unknown Het
Togaram1 A G 12: 65,013,709 (GRCm39) Y320C probably damaging Het
Trim41 A G 11: 48,698,319 (GRCm39) V549A probably damaging Het
Ugt2b1 T A 5: 87,065,700 (GRCm39) L446F probably damaging Het
Unc5b T C 10: 60,608,348 (GRCm39) T621A probably benign Het
Utp25 T A 1: 192,800,617 (GRCm39) K401I probably damaging Het
Vmn1r214 C A 13: 23,219,494 (GRCm39) H329Q possibly damaging Het
Vmn2r109 T A 17: 20,774,072 (GRCm39) K428* probably null Het
Vmn2r81 A C 10: 79,129,328 (GRCm39) I740L probably damaging Het
Wdfy3 A G 5: 102,089,358 (GRCm39) L612P probably damaging Het
Zfp109 G A 7: 23,928,161 (GRCm39) T424M probably damaging Het
Zfp735 A T 11: 73,602,677 (GRCm39) K540N possibly damaging Het
Other mutations in Gpld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gpld1 APN 13 25,170,905 (GRCm39) splice site probably benign
IGL00886:Gpld1 APN 13 25,146,336 (GRCm39) nonsense probably null
IGL01060:Gpld1 APN 13 25,166,549 (GRCm39) missense probably damaging 1.00
IGL01450:Gpld1 APN 13 25,163,664 (GRCm39) missense probably damaging 1.00
IGL02176:Gpld1 APN 13 25,168,192 (GRCm39) critical splice donor site probably null
IGL02288:Gpld1 APN 13 25,163,666 (GRCm39) nonsense probably null
IGL02323:Gpld1 APN 13 25,166,757 (GRCm39) missense probably damaging 0.97
IGL02588:Gpld1 APN 13 25,127,682 (GRCm39) missense probably damaging 1.00
IGL02832:Gpld1 APN 13 25,136,861 (GRCm39) missense probably damaging 1.00
IGL02989:Gpld1 APN 13 25,174,019 (GRCm39) missense possibly damaging 0.87
IGL03282:Gpld1 APN 13 25,155,391 (GRCm39) missense probably benign 0.01
IGL03345:Gpld1 APN 13 25,171,007 (GRCm39) missense probably damaging 1.00
R0017:Gpld1 UTSW 13 25,174,101 (GRCm39) missense probably damaging 1.00
R0017:Gpld1 UTSW 13 25,174,101 (GRCm39) missense probably damaging 1.00
R0308:Gpld1 UTSW 13 25,146,818 (GRCm39) missense possibly damaging 0.81
R0441:Gpld1 UTSW 13 25,146,303 (GRCm39) nonsense probably null
R1172:Gpld1 UTSW 13 25,141,549 (GRCm39) splice site probably null
R1411:Gpld1 UTSW 13 25,146,791 (GRCm39) missense probably damaging 0.99
R1502:Gpld1 UTSW 13 25,155,399 (GRCm39) missense probably benign 0.00
R1565:Gpld1 UTSW 13 25,140,051 (GRCm39) missense probably damaging 0.99
R1999:Gpld1 UTSW 13 25,146,630 (GRCm39) missense probably benign 0.23
R2150:Gpld1 UTSW 13 25,146,630 (GRCm39) missense probably benign 0.23
R2240:Gpld1 UTSW 13 25,166,490 (GRCm39) critical splice acceptor site probably null
R2327:Gpld1 UTSW 13 25,168,804 (GRCm39) missense probably benign 0.00
R2373:Gpld1 UTSW 13 25,146,839 (GRCm39) missense probably benign 0.26
R3153:Gpld1 UTSW 13 25,127,603 (GRCm39) missense unknown
R3154:Gpld1 UTSW 13 25,140,146 (GRCm39) critical splice donor site probably null
R3154:Gpld1 UTSW 13 25,127,603 (GRCm39) missense unknown
R3911:Gpld1 UTSW 13 25,146,305 (GRCm39) missense probably damaging 1.00
R4616:Gpld1 UTSW 13 25,168,799 (GRCm39) missense probably damaging 1.00
R4660:Gpld1 UTSW 13 25,166,586 (GRCm39) splice site probably null
R4755:Gpld1 UTSW 13 25,163,675 (GRCm39) nonsense probably null
R4755:Gpld1 UTSW 13 25,163,671 (GRCm39) missense probably benign 0.13
R4835:Gpld1 UTSW 13 25,166,699 (GRCm39) missense probably benign 0.00
R4895:Gpld1 UTSW 13 25,163,711 (GRCm39) missense probably damaging 0.97
R5050:Gpld1 UTSW 13 25,146,739 (GRCm39) missense probably benign 0.00
R5182:Gpld1 UTSW 13 25,168,053 (GRCm39) splice site probably null
R6161:Gpld1 UTSW 13 25,155,397 (GRCm39) missense probably benign 0.00
R6626:Gpld1 UTSW 13 25,163,953 (GRCm39) missense probably damaging 1.00
R7021:Gpld1 UTSW 13 25,168,691 (GRCm39) missense probably damaging 1.00
R7577:Gpld1 UTSW 13 25,146,388 (GRCm39) missense probably benign 0.05
R7583:Gpld1 UTSW 13 25,159,743 (GRCm39) missense probably damaging 1.00
R7659:Gpld1 UTSW 13 25,163,964 (GRCm39) missense probably benign 0.00
R7737:Gpld1 UTSW 13 25,159,709 (GRCm39) missense probably damaging 1.00
R7738:Gpld1 UTSW 13 25,146,305 (GRCm39) missense probably damaging 1.00
R7752:Gpld1 UTSW 13 25,146,758 (GRCm39) missense probably damaging 1.00
R7759:Gpld1 UTSW 13 25,146,383 (GRCm39) missense probably damaging 0.99
R7901:Gpld1 UTSW 13 25,146,758 (GRCm39) missense probably damaging 1.00
R8855:Gpld1 UTSW 13 25,170,890 (GRCm39) missense probably benign 0.00
R8866:Gpld1 UTSW 13 25,170,890 (GRCm39) missense probably benign 0.00
R9150:Gpld1 UTSW 13 25,146,305 (GRCm39) missense probably damaging 1.00
R9228:Gpld1 UTSW 13 25,136,900 (GRCm39) missense probably damaging 1.00
R9359:Gpld1 UTSW 13 25,163,712 (GRCm39) missense probably benign 0.00
R9403:Gpld1 UTSW 13 25,163,712 (GRCm39) missense probably benign 0.00
X0024:Gpld1 UTSW 13 25,166,579 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCCTGGATTTGGGAGTCA -3'
(R):5'- TAAGTTCATTGATGGATTCTTGTCC -3'

Sequencing Primer
(F):5'- GAGTCATAGTTTGGCTACAGCTAAG -3'
(R):5'- CCAAGGTAGCCAGAACTA -3'
Posted On 2014-07-14