Mutagenetix > Incidental Mutation

Incidental Mutation 'R1931:Gpld1'

215390

Institutional Source

Beutler Lab

Gene Symbol

Gpld1

Ensembl Gene

ENSMUSG00000021340

Gene Name

glycosylphosphatidylinositol specific phospholipase D1

Synonyms

6330541J12Rik

MMRRC Submission

039949-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1931 (G1)

Quality Score

181

Status

Not validated

Chromosome

Chromosomal Location

24943152-24992501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24943710 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 32 (I32L)

Ref Sequence

ENSEMBL: ENSMUSP00000021773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021773]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021773
AA Change: I32L

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: I32L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Zn_dep_PLPC	28	219	9.8e-28	PFAM
Int_alpha	377	435	7.21e-11	SMART
Int_alpha	446	503	7.43e-13	SMART
Int_alpha	509	565	7.86e-3	SMART
Int_alpha	576	643	4.09e0	SMART
Blast:Int_alpha	644	708	2e-24	BLAST
Int_alpha	716	774	1.86e-4	SMART
Blast:Int_alpha	789	837	1e-16	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154919

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
Aak1	T	G	6: 86,956,336	S430A	unknown	Het
Abhd16a	T	A	17: 35,101,015	F337L	probably benign	Het
Acsl1	C	A	8: 46,530,986	A514E	probably benign	Het
Adam29	T	C	8: 55,873,089	Y110C	probably damaging	Het
Adamts12	C	A	15: 11,270,599	Q647K	probably benign	Het
Adamts20	T	A	15: 94,404,010	H27L	probably benign	Het
Adamtsl1	A	G	4: 86,342,411	E961G	possibly damaging	Het
AU022751	T	C	X: 6,082,763	E66G	probably benign	Het
AW011738	T	C	4: 156,203,540		probably benign	Het
Bcl9	T	C	3: 97,205,144	M1332V	probably damaging	Het
Birc6	T	C	17: 74,565,982	I412T	probably damaging	Het
Cav1	A	T	6: 17,339,332	I139F	probably damaging	Het
Col4a4	A	C	1: 82,466,600		probably null	Het
Coro2a	A	T	4: 46,539,138	*544R	probably null	Het
Cox15	C	T	19: 43,746,785	R181H	probably benign	Het
Ddx23	G	A	15: 98,650,718	R370W	possibly damaging	Het
Dennd2c	A	G	3: 103,133,252	N278D	probably benign	Het
Dgkh	T	C	14: 78,616,505	I265V	probably damaging	Het
Diexf	T	A	1: 193,118,309	K401I	probably damaging	Het
Dpp3	A	T	19: 4,917,860		probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Ece1	A	G	4: 137,938,763	K306R	probably benign	Het
Eif4b	T	C	15: 102,088,976	S309P	unknown	Het
Eml3	G	A	19: 8,937,143	V507M	probably benign	Het
Fat1	C	T	8: 45,044,228	T4250M	possibly damaging	Het
Fezf1	T	G	6: 23,246,907	I309L	probably damaging	Het
Fsip2	T	A	2: 82,986,733	L4270H	probably damaging	Het
Gabra4	T	C	5: 71,638,237	K206E	probably damaging	Het
Gfm1	A	G	3: 67,456,585	K465E	probably benign	Het
Hist1h4k	A	T	13: 21,750,512		probably null	Het
Hoxd12	A	G	2: 74,675,513	T143A	probably benign	Het
Hoxd12	A	G	2: 74,675,531	T149A	probably benign	Het
Hspg2	T	A	4: 137,540,230	S2050T	probably damaging	Het
Il31ra	T	A	13: 112,541,222	N287I	probably damaging	Het
Itga4	G	A	2: 79,313,844		probably null	Het
Itpr2	A	G	6: 146,240,354	V1730A	probably benign	Het
Klkb1	T	A	8: 45,275,477	Q415L	probably benign	Het
Lcn10	A	G	2: 25,684,335	Y118C	probably damaging	Het
Lgi3	T	C	14: 70,536,268	V294A	probably damaging	Het
Lrp5	C	T	19: 3,610,131	V978I	probably benign	Het
Naaa	A	G	5: 92,278,035	V33A	probably benign	Het
Nckap5l	A	G	15: 99,427,261	F454L	probably damaging	Het
Nol10	A	G	12: 17,348,554	M1V	probably null	Het
Olfm1	G	A	2: 28,222,662		probably null	Het
Olfr520	G	T	7: 99,735,860	R239L	possibly damaging	Het
Olfr784	T	A	10: 129,387,876	M81K	probably benign	Het
Olfr849	T	C	9: 19,441,351	L146P	possibly damaging	Het
Osbp2	T	C	11: 3,726,333		probably null	Het
Osbpl1a	T	A	18: 12,905,194	Q269L	probably benign	Het
Papss2	T	A	19: 32,638,968	C191*	probably null	Het
Pbxip1	A	T	3: 89,447,677		probably null	Het
Pdp1	A	G	4: 11,962,074	I79T	probably benign	Het
Peg10	A	G	6: 4,755,778	Y118C	probably damaging	Het
Pnisr	A	G	4: 21,873,612	T452A	probably benign	Het
Polr2a	A	T	11: 69,735,375	Y1612N	unknown	Het
Polr3c	A	T	3: 96,719,298	L270H	probably damaging	Het
Prr11	A	T	11: 87,106,042	L32*	probably null	Het
Ptgfr	T	A	3: 151,835,194	T226S	probably benign	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rps6kb1	A	G	11: 86,532,821	V111A	possibly damaging	Het
Sfxn1	A	T	13: 54,093,933	I226F	probably damaging	Het
Sh3pxd2a	A	G	19: 47,267,508	S924P	probably benign	Het
Slc16a5	A	T	11: 115,469,368	I126F	probably damaging	Het
Slc8a3	G	T	12: 81,314,446	T533N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spata3	A	C	1: 86,022,061		probably benign	Het
St8sia6	A	G	2: 13,792,812	S48P	probably benign	Het
Stra6l	A	T	4: 45,882,698	R470*	probably null	Het
Stradb	A	C	1: 58,991,105	N173H	probably benign	Het
Sugp1	T	A	8: 70,071,540	D598E	probably benign	Het
Tekt2	T	C	4: 126,322,817		probably null	Het
Tiam2	C	T	17: 3,514,725	R1413C	possibly damaging	Het
Tmprss2	T	C	16: 97,569,062	S301G	probably benign	Het
Tnrc18	A	T	5: 142,776,324	N515K	unknown	Het
Togaram1	A	G	12: 64,966,935	Y320C	probably damaging	Het
Trim41	A	G	11: 48,807,492	V549A	probably damaging	Het
Ugt2b1	T	A	5: 86,917,841	L446F	probably damaging	Het
Unc5b	T	C	10: 60,772,569	T621A	probably benign	Het
Vmn1r214	C	A	13: 23,035,324	H329Q	possibly damaging	Het
Vmn2r109	T	A	17: 20,553,810	K428*	probably null	Het
Vmn2r81	A	C	10: 79,293,494	I740L	probably damaging	Het
Wdfy3	A	G	5: 101,941,492	L612P	probably damaging	Het
Zfp109	G	A	7: 24,228,736	T424M	probably damaging	Het
Zfp735	A	T	11: 73,711,851	K540N	possibly damaging	Het

Other mutations in Gpld1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Gpld1	APN	13	24986922	splice site	probably benign
IGL00886:Gpld1	APN	13	24962353	nonsense	probably null
IGL01060:Gpld1	APN	13	24982566	missense	probably damaging	1.00
IGL01450:Gpld1	APN	13	24979681	missense	probably damaging	1.00
IGL02176:Gpld1	APN	13	24984209	critical splice donor site	probably null
IGL02288:Gpld1	APN	13	24979683	nonsense	probably null
IGL02323:Gpld1	APN	13	24982774	missense	probably damaging	0.97
IGL02588:Gpld1	APN	13	24943699	missense	probably damaging	1.00
IGL02832:Gpld1	APN	13	24952878	missense	probably damaging	1.00
IGL02989:Gpld1	APN	13	24990036	missense	possibly damaging	0.87
IGL03282:Gpld1	APN	13	24971408	missense	probably benign	0.01
IGL03345:Gpld1	APN	13	24987024	missense	probably damaging	1.00
R0017:Gpld1	UTSW	13	24990118	missense	probably damaging	1.00
R0017:Gpld1	UTSW	13	24990118	missense	probably damaging	1.00
R0308:Gpld1	UTSW	13	24962835	missense	possibly damaging	0.81
R0441:Gpld1	UTSW	13	24962320	nonsense	probably null
R1172:Gpld1	UTSW	13	24957566	splice site	probably null
R1411:Gpld1	UTSW	13	24962808	missense	probably damaging	0.99
R1502:Gpld1	UTSW	13	24971416	missense	probably benign	0.00
R1565:Gpld1	UTSW	13	24956068	missense	probably damaging	0.99
R1999:Gpld1	UTSW	13	24962647	missense	probably benign	0.23
R2150:Gpld1	UTSW	13	24962647	missense	probably benign	0.23
R2240:Gpld1	UTSW	13	24982507	critical splice acceptor site	probably null
R2327:Gpld1	UTSW	13	24984821	missense	probably benign	0.00
R2373:Gpld1	UTSW	13	24962856	missense	probably benign	0.26
R3153:Gpld1	UTSW	13	24943620	missense	unknown
R3154:Gpld1	UTSW	13	24943620	missense	unknown
R3154:Gpld1	UTSW	13	24956163	critical splice donor site	probably null
R3911:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R4616:Gpld1	UTSW	13	24984816	missense	probably damaging	1.00
R4660:Gpld1	UTSW	13	24982603	splice site	probably null
R4755:Gpld1	UTSW	13	24979688	missense	probably benign	0.13
R4755:Gpld1	UTSW	13	24979692	nonsense	probably null
R4835:Gpld1	UTSW	13	24982716	missense	probably benign	0.00
R4895:Gpld1	UTSW	13	24979728	missense	probably damaging	0.97
R5050:Gpld1	UTSW	13	24962756	missense	probably benign	0.00
R5182:Gpld1	UTSW	13	24984070	splice site	probably null
R6161:Gpld1	UTSW	13	24971414	missense	probably benign	0.00
R6626:Gpld1	UTSW	13	24979970	missense	probably damaging	1.00
R7021:Gpld1	UTSW	13	24984708	missense	probably damaging	1.00
R7577:Gpld1	UTSW	13	24962405	missense	probably benign	0.05
R7583:Gpld1	UTSW	13	24975760	missense	probably damaging	1.00
R7659:Gpld1	UTSW	13	24979981	missense	probably benign	0.00
R7737:Gpld1	UTSW	13	24975726	missense	probably damaging	1.00
R7738:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R7752:Gpld1	UTSW	13	24962775	missense	probably damaging	1.00
R7759:Gpld1	UTSW	13	24962400	missense	probably damaging	0.99
R7901:Gpld1	UTSW	13	24962775	missense	probably damaging	1.00
R8855:Gpld1	UTSW	13	24986907	missense	probably benign	0.00
R8866:Gpld1	UTSW	13	24986907	missense	probably benign	0.00
R9150:Gpld1	UTSW	13	24962322	missense	probably damaging	1.00
R9228:Gpld1	UTSW	13	24952917	missense	probably damaging	1.00
R9359:Gpld1	UTSW	13	24979729	missense	probably benign	0.00
R9403:Gpld1	UTSW	13	24979729	missense	probably benign	0.00
X0024:Gpld1	UTSW	13	24982596	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTGCCTGGATTTGGGAGTCA -3'
(R):5'- TAAGTTCATTGATGGATTCTTGTCC -3'

Sequencing Primer
(F):5'- GAGTCATAGTTTGGCTACAGCTAAG -3'
(R):5'- CCAAGGTAGCCAGAACTA -3'

Posted On

2014-07-14