Incidental Mutation 'R1931:Adamts12'
ID 215397
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
MMRRC Submission 039949-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R1931 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 11270685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 647 (Q647K)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably benign
Transcript: ENSMUST00000061318
AA Change: Q647K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: Q647K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T G 6: 86,933,318 (GRCm39) S430A unknown Het
Abhd16a T A 17: 35,319,991 (GRCm39) F337L probably benign Het
Acsl1 C A 8: 46,984,023 (GRCm39) A514E probably benign Het
Adam29 T C 8: 56,326,124 (GRCm39) Y110C probably damaging Het
Adamts20 T A 15: 94,301,891 (GRCm39) H27L probably benign Het
Adamtsl1 A G 4: 86,260,648 (GRCm39) E961G possibly damaging Het
AW011738 T C 4: 156,287,997 (GRCm39) probably benign Het
Bcl9 T C 3: 97,112,460 (GRCm39) M1332V probably damaging Het
Birc6 T C 17: 74,872,977 (GRCm39) I412T probably damaging Het
Cav1 A T 6: 17,339,331 (GRCm39) I139F probably damaging Het
Col4a4 A C 1: 82,444,321 (GRCm39) probably null Het
Coro2a A T 4: 46,539,138 (GRCm39) *544R probably null Het
Cox15 C T 19: 43,735,224 (GRCm39) R181H probably benign Het
Ddx23 G A 15: 98,548,599 (GRCm39) R370W possibly damaging Het
Dennd2c A G 3: 103,040,568 (GRCm39) N278D probably benign Het
Dgkh T C 14: 78,853,945 (GRCm39) I265V probably damaging Het
Dpp3 A T 19: 4,967,888 (GRCm39) probably benign Het
Drc7 G A 8: 95,797,881 (GRCm39) R433H possibly damaging Het
Ece1 A G 4: 137,666,074 (GRCm39) K306R probably benign Het
Eif4b T C 15: 101,997,411 (GRCm39) S309P unknown Het
Eml3 G A 19: 8,914,507 (GRCm39) V507M probably benign Het
Ezhip T C X: 5,994,817 (GRCm39) E66G probably benign Het
Fat1 C T 8: 45,497,265 (GRCm39) T4250M possibly damaging Het
Fezf1 T G 6: 23,246,906 (GRCm39) I309L probably damaging Het
Fsip2 T A 2: 82,817,077 (GRCm39) L4270H probably damaging Het
Gabra4 T C 5: 71,795,580 (GRCm39) K206E probably damaging Het
Gfm1 A G 3: 67,363,918 (GRCm39) K465E probably benign Het
Gpld1 A T 13: 25,127,693 (GRCm39) I32L possibly damaging Het
H4c12 A T 13: 21,934,682 (GRCm39) probably null Het
Hoxd12 A G 2: 74,505,857 (GRCm39) T143A probably benign Het
Hoxd12 A G 2: 74,505,875 (GRCm39) T149A probably benign Het
Hspg2 T A 4: 137,267,541 (GRCm39) S2050T probably damaging Het
Il31ra T A 13: 112,677,756 (GRCm39) N287I probably damaging Het
Itga4 G A 2: 79,144,188 (GRCm39) probably null Het
Itpr2 A G 6: 146,141,852 (GRCm39) V1730A probably benign Het
Klkb1 T A 8: 45,728,514 (GRCm39) Q415L probably benign Het
Lcn10 A G 2: 25,574,347 (GRCm39) Y118C probably damaging Het
Lgi3 T C 14: 70,773,708 (GRCm39) V294A probably damaging Het
Lrp5 C T 19: 3,660,131 (GRCm39) V978I probably benign Het
Naaa A G 5: 92,425,894 (GRCm39) V33A probably benign Het
Nckap5l A G 15: 99,325,142 (GRCm39) F454L probably damaging Het
Nol10 A G 12: 17,398,555 (GRCm39) M1V probably null Het
Olfm1 G A 2: 28,112,674 (GRCm39) probably null Het
Or2at4 G T 7: 99,385,067 (GRCm39) R239L possibly damaging Het
Or6c208 T A 10: 129,223,745 (GRCm39) M81K probably benign Het
Or7g30 T C 9: 19,352,647 (GRCm39) L146P possibly damaging Het
Osbp2 T C 11: 3,676,333 (GRCm39) probably null Het
Osbpl1a T A 18: 13,038,251 (GRCm39) Q269L probably benign Het
Papss2 T A 19: 32,616,368 (GRCm39) C191* probably null Het
Pbxip1 A T 3: 89,354,984 (GRCm39) probably null Het
Pdp1 A G 4: 11,962,074 (GRCm39) I79T probably benign Het
Peg10 A G 6: 4,755,778 (GRCm39) Y118C probably damaging Het
Pnisr A G 4: 21,873,612 (GRCm39) T452A probably benign Het
Polr2a A T 11: 69,626,201 (GRCm39) Y1612N unknown Het
Polr3c A T 3: 96,626,614 (GRCm39) L270H probably damaging Het
Prr11 A T 11: 86,996,868 (GRCm39) L32* probably null Het
Ptgfr T A 3: 151,540,831 (GRCm39) T226S probably benign Het
Ptprz1 T A 6: 23,007,354 (GRCm39) V1639E probably damaging Het
Pttg1ip2 C A 5: 5,502,019 (GRCm39) W144C probably benign Het
Rps6kb1 A G 11: 86,423,647 (GRCm39) V111A possibly damaging Het
Sfxn1 A T 13: 54,247,952 (GRCm39) I226F probably damaging Het
Sh3pxd2a A G 19: 47,255,947 (GRCm39) S924P probably benign Het
Slc16a5 A T 11: 115,360,194 (GRCm39) I126F probably damaging Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Spata3 A C 1: 85,949,783 (GRCm39) probably benign Het
St8sia6 A G 2: 13,797,623 (GRCm39) S48P probably benign Het
Stra6l A T 4: 45,882,698 (GRCm39) R470* probably null Het
Stradb A C 1: 59,030,264 (GRCm39) N173H probably benign Het
Sugp1 T A 8: 70,524,190 (GRCm39) D598E probably benign Het
Tekt2 T C 4: 126,216,610 (GRCm39) probably null Het
Tiam2 C T 17: 3,565,000 (GRCm39) R1413C possibly damaging Het
Tmprss2 T C 16: 97,370,262 (GRCm39) S301G probably benign Het
Tnrc18 A T 5: 142,762,079 (GRCm39) N515K unknown Het
Togaram1 A G 12: 65,013,709 (GRCm39) Y320C probably damaging Het
Trim41 A G 11: 48,698,319 (GRCm39) V549A probably damaging Het
Ugt2b1 T A 5: 87,065,700 (GRCm39) L446F probably damaging Het
Unc5b T C 10: 60,608,348 (GRCm39) T621A probably benign Het
Utp25 T A 1: 192,800,617 (GRCm39) K401I probably damaging Het
Vmn1r214 C A 13: 23,219,494 (GRCm39) H329Q possibly damaging Het
Vmn2r109 T A 17: 20,774,072 (GRCm39) K428* probably null Het
Vmn2r81 A C 10: 79,129,328 (GRCm39) I740L probably damaging Het
Wdfy3 A G 5: 102,089,358 (GRCm39) L612P probably damaging Het
Zfp109 G A 7: 23,928,161 (GRCm39) T424M probably damaging Het
Zfp735 A T 11: 73,602,677 (GRCm39) K540N possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1748:Adamts12 UTSW 15 11,241,548 (GRCm39) missense probably damaging 0.99
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCACATTTTATCTAGTGTGTC -3'
(R):5'- TGTTTATCACAGCAACAGAAAGCAG -3'

Sequencing Primer
(F):5'- TATCTAGTGTGTCAGAAAGTCAAAGG -3'
(R):5'- CCCCACAACAGATTCAAGTAAATAC -3'
Posted On 2014-07-14