Mutagenetix > Incidental Mutation

Incidental Mutation 'R1931:Adamts20'

215400

Institutional Source

Beutler Lab

Gene Symbol

Adamts20

Ensembl Gene

ENSMUSG00000022449

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20

Synonyms

ADAMTS-20, bt

MMRRC Submission

039949-MU

Accession Numbers

Genbank: NM_177431; MGI: 2660628

Essential gene?

Probably non essential (E-score: 0.161) question?

Stock #

R1931 (G1)

Quality Score

213

Status

Not validated

Chromosome

Chromosomal Location

94270163-94465418 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 94404010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 27 (H27L)

Ref Sequence

ENSEMBL: ENSMUSP00000121696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035342] [ENSMUST00000155907]

AlphaFold

P59511

Predicted Effect

probably benign
Transcript: ENSMUST00000035342
AA Change: H27L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: H27L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	186	1.4e-30	PFAM
Pfam:Reprolysin_5	253	445	3.6e-13	PFAM
Pfam:Reprolysin_4	253	460	1.1e-7	PFAM
Pfam:Reprolysin	255	464	1.5e-26	PFAM
Pfam:Reprolysin_2	272	454	1.8e-10	PFAM
Pfam:Reprolysin_3	276	410	5.8e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2.6e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART
TSP1	1416	1470	1.69e-2	SMART
TSP1	1471	1526	2.3e0	SMART
TSP1	1530	1579	1.23e0	SMART
TSP1	1653	1706	5.27e-4	SMART
Pfam:GON	1708	1905	5.8e-80	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128797

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129195

Predicted Effect

probably benign
Transcript: ENSMUST00000155907
AA Change: H27L

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000121696
Gene: ENSMUSG00000022449
AA Change: H27L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	40	186	1e-31	PFAM
Pfam:Reprolysin_5	253	445	2.7e-13	PFAM
Pfam:Reprolysin_4	253	460	7.2e-8	PFAM
Pfam:Reprolysin	255	464	2.4e-28	PFAM
Pfam:Reprolysin_2	272	454	4e-10	PFAM
Pfam:Reprolysin_3	276	410	1.1e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART

Coding Region Coverage

1x: 97.3%
3x: 96.8%
10x: 95.3%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	C	A	5: 5,452,019	W144C	probably benign	Het
Aak1	T	G	6: 86,956,336	S430A	unknown	Het
Abhd16a	T	A	17: 35,101,015	F337L	probably benign	Het
Acsl1	C	A	8: 46,530,986	A514E	probably benign	Het
Adam29	T	C	8: 55,873,089	Y110C	probably damaging	Het
Adamts12	C	A	15: 11,270,599	Q647K	probably benign	Het
Adamtsl1	A	G	4: 86,342,411	E961G	possibly damaging	Het
AU022751	T	C	X: 6,082,763	E66G	probably benign	Het
AW011738	T	C	4: 156,203,540		probably benign	Het
Bcl9	T	C	3: 97,205,144	M1332V	probably damaging	Het
Birc6	T	C	17: 74,565,982	I412T	probably damaging	Het
Cav1	A	T	6: 17,339,332	I139F	probably damaging	Het
Col4a4	A	C	1: 82,466,600		probably null	Het
Coro2a	A	T	4: 46,539,138	*544R	probably null	Het
Cox15	C	T	19: 43,746,785	R181H	probably benign	Het
Ddx23	G	A	15: 98,650,718	R370W	possibly damaging	Het
Dennd2c	A	G	3: 103,133,252	N278D	probably benign	Het
Dgkh	T	C	14: 78,616,505	I265V	probably damaging	Het
Diexf	T	A	1: 193,118,309	K401I	probably damaging	Het
Dpp3	A	T	19: 4,917,860		probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Ece1	A	G	4: 137,938,763	K306R	probably benign	Het
Eif4b	T	C	15: 102,088,976	S309P	unknown	Het
Eml3	G	A	19: 8,937,143	V507M	probably benign	Het
Fat1	C	T	8: 45,044,228	T4250M	possibly damaging	Het
Fezf1	T	G	6: 23,246,907	I309L	probably damaging	Het
Fsip2	T	A	2: 82,986,733	L4270H	probably damaging	Het
Gabra4	T	C	5: 71,638,237	K206E	probably damaging	Het
Gfm1	A	G	3: 67,456,585	K465E	probably benign	Het
Gpld1	A	T	13: 24,943,710	I32L	possibly damaging	Het
Hist1h4k	A	T	13: 21,750,512		probably null	Het
Hoxd12	A	G	2: 74,675,513	T143A	probably benign	Het
Hoxd12	A	G	2: 74,675,531	T149A	probably benign	Het
Hspg2	T	A	4: 137,540,230	S2050T	probably damaging	Het
Il31ra	T	A	13: 112,541,222	N287I	probably damaging	Het
Itga4	G	A	2: 79,313,844		probably null	Het
Itpr2	A	G	6: 146,240,354	V1730A	probably benign	Het
Klkb1	T	A	8: 45,275,477	Q415L	probably benign	Het
Lcn10	A	G	2: 25,684,335	Y118C	probably damaging	Het
Lgi3	T	C	14: 70,536,268	V294A	probably damaging	Het
Lrp5	C	T	19: 3,610,131	V978I	probably benign	Het
Naaa	A	G	5: 92,278,035	V33A	probably benign	Het
Nckap5l	A	G	15: 99,427,261	F454L	probably damaging	Het
Nol10	A	G	12: 17,348,554	M1V	probably null	Het
Olfm1	G	A	2: 28,222,662		probably null	Het
Olfr520	G	T	7: 99,735,860	R239L	possibly damaging	Het
Olfr784	T	A	10: 129,387,876	M81K	probably benign	Het
Olfr849	T	C	9: 19,441,351	L146P	possibly damaging	Het
Osbp2	T	C	11: 3,726,333		probably null	Het
Osbpl1a	T	A	18: 12,905,194	Q269L	probably benign	Het
Papss2	T	A	19: 32,638,968	C191*	probably null	Het
Pbxip1	A	T	3: 89,447,677		probably null	Het
Pdp1	A	G	4: 11,962,074	I79T	probably benign	Het
Peg10	A	G	6: 4,755,778	Y118C	probably damaging	Het
Pnisr	A	G	4: 21,873,612	T452A	probably benign	Het
Polr2a	A	T	11: 69,735,375	Y1612N	unknown	Het
Polr3c	A	T	3: 96,719,298	L270H	probably damaging	Het
Prr11	A	T	11: 87,106,042	L32*	probably null	Het
Ptgfr	T	A	3: 151,835,194	T226S	probably benign	Het
Ptprz1	T	A	6: 23,007,355	V1639E	probably damaging	Het
Rps6kb1	A	G	11: 86,532,821	V111A	possibly damaging	Het
Sfxn1	A	T	13: 54,093,933	I226F	probably damaging	Het
Sh3pxd2a	A	G	19: 47,267,508	S924P	probably benign	Het
Slc16a5	A	T	11: 115,469,368	I126F	probably damaging	Het
Slc8a3	G	T	12: 81,314,446	T533N	probably damaging	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Spata3	A	C	1: 86,022,061		probably benign	Het
St8sia6	A	G	2: 13,792,812	S48P	probably benign	Het
Stra6l	A	T	4: 45,882,698	R470*	probably null	Het
Stradb	A	C	1: 58,991,105	N173H	probably benign	Het
Sugp1	T	A	8: 70,071,540	D598E	probably benign	Het
Tekt2	T	C	4: 126,322,817		probably null	Het
Tiam2	C	T	17: 3,514,725	R1413C	possibly damaging	Het
Tmprss2	T	C	16: 97,569,062	S301G	probably benign	Het
Tnrc18	A	T	5: 142,776,324	N515K	unknown	Het
Togaram1	A	G	12: 64,966,935	Y320C	probably damaging	Het
Trim41	A	G	11: 48,807,492	V549A	probably damaging	Het
Ugt2b1	T	A	5: 86,917,841	L446F	probably damaging	Het
Unc5b	T	C	10: 60,772,569	T621A	probably benign	Het
Vmn1r214	C	A	13: 23,035,324	H329Q	possibly damaging	Het
Vmn2r109	T	A	17: 20,553,810	K428*	probably null	Het
Vmn2r81	A	C	10: 79,293,494	I740L	probably damaging	Het
Wdfy3	A	G	5: 101,941,492	L612P	probably damaging	Het
Zfp109	G	A	7: 24,228,736	T424M	probably damaging	Het
Zfp735	A	T	11: 73,711,851	K540N	possibly damaging	Het

Other mutations in Adamts20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Adamts20	APN	15	94394641	missense	probably benign
IGL00491:Adamts20	APN	15	94273232	missense	possibly damaging	0.89
IGL00502:Adamts20	APN	15	94403397	missense	probably damaging	0.99
IGL00672:Adamts20	APN	15	94341105	missense	probably damaging	0.99
IGL00840:Adamts20	APN	15	94282482	missense	probably damaging	1.00
IGL00909:Adamts20	APN	15	94379813	missense	probably damaging	1.00
IGL01101:Adamts20	APN	15	94344042	missense	probably damaging	1.00
IGL01137:Adamts20	APN	15	94394611	critical splice donor site	probably null
IGL01457:Adamts20	APN	15	94331448	missense	probably damaging	0.97
IGL01685:Adamts20	APN	15	94403446	missense	possibly damaging	0.81
IGL01949:Adamts20	APN	15	94326106	missense	probably benign	0.08
IGL02525:Adamts20	APN	15	94283078	splice site	probably null
IGL03088:Adamts20	APN	15	94329914	critical splice donor site	probably null
IGL03175:Adamts20	APN	15	94273255	nonsense	probably null
belt	UTSW	15	94345990	missense	probably damaging	1.00
buckeye	UTSW	15	94341087	missense	probably damaging	1.00
jack_white	UTSW	15		unclassified
meowth	UTSW	15	94331458	missense	probably damaging	1.00
nidoking	UTSW	15	94403445	missense	probably damaging	1.00
panda	UTSW	15	94326699	intron	probably benign
pikachu	UTSW	15	94345990	missense	probably damaging	1.00
poliwag	UTSW	15	94394622	nonsense	probably null
splotch2	UTSW	15	94335561	intron	probably benign
wash	UTSW	15	94347670	nonsense	probably null
whitebelly	UTSW	15		unclassified
whopper	UTSW	15	94347810	missense	probably damaging	1.00
R0483:Adamts20	UTSW	15	94353571	missense	probably benign	0.00
R0514:Adamts20	UTSW	15	94270376	missense	probably damaging	1.00
R0568:Adamts20	UTSW	15	94291713	splice site	probably benign
R0730:Adamts20	UTSW	15	94347690	missense	probably benign	0.00
R0973:Adamts20	UTSW	15	94286371	missense	probably benign	0.00
R1339:Adamts20	UTSW	15	94322896	missense	probably benign	0.19
R1721:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1809:Adamts20	UTSW	15	94341087	missense	probably damaging	1.00
R1832:Adamts20	UTSW	15	94286344	missense	probably benign	0.00
R1846:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R1867:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1875:Adamts20	UTSW	15	94331396	missense	probably benign	0.01
R1930:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1932:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R2001:Adamts20	UTSW	15	94347718	missense	possibly damaging	0.96
R2116:Adamts20	UTSW	15	94355362	missense	probably damaging	1.00
R2162:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R2350:Adamts20	UTSW	15	94283916	missense	probably damaging	1.00
R2887:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2889:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2890:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R3109:Adamts20	UTSW	15	94345904	splice site	probably benign
R3719:Adamts20	UTSW	15	94361838	missense	probably damaging	0.99
R3832:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R3901:Adamts20	UTSW	15	94328845	missense	possibly damaging	0.81
R4398:Adamts20	UTSW	15	94333695	missense	possibly damaging	0.93
R4402:Adamts20	UTSW	15	94379946	missense	probably benign
R4431:Adamts20	UTSW	15	94344043	missense	probably damaging	1.00
R4479:Adamts20	UTSW	15	94403445	missense	probably damaging	1.00
R4482:Adamts20	UTSW	15	94345920	missense	probably damaging	1.00
R4503:Adamts20	UTSW	15	94379750	missense	probably damaging	0.99
R4671:Adamts20	UTSW	15	94403325	missense	possibly damaging	0.48
R4700:Adamts20	UTSW	15	94394622	nonsense	probably null
R4707:Adamts20	UTSW	15	94333647	missense	possibly damaging	0.53
R4725:Adamts20	UTSW	15	94351762	missense	probably damaging	0.99
R4771:Adamts20	UTSW	15	94351635	splice site	probably null
R4829:Adamts20	UTSW	15	94326396	missense	probably benign	0.01
R4937:Adamts20	UTSW	15	94379775	missense	probably benign
R4960:Adamts20	UTSW	15	94379774	missense	probably benign
R5270:Adamts20	UTSW	15	94282519	missense	probably benign	0.00
R5388:Adamts20	UTSW	15	94345778	missense	possibly damaging	0.81
R5410:Adamts20	UTSW	15	94281957	missense	possibly damaging	0.94
R5453:Adamts20	UTSW	15	94326088	missense	possibly damaging	0.69
R5611:Adamts20	UTSW	15	94273280	missense	possibly damaging	0.65
R5687:Adamts20	UTSW	15	94325971	missense	probably benign	0.36
R5758:Adamts20	UTSW	15	94394650	missense	probably benign	0.00
R5801:Adamts20	UTSW	15	94347670	nonsense	probably null
R5834:Adamts20	UTSW	15	94353584	missense	probably damaging	0.99
R5993:Adamts20	UTSW	15	94338723	missense	probably damaging	0.99
R5997:Adamts20	UTSW	15	94379747	missense	probably damaging	1.00
R6044:Adamts20	UTSW	15	94282483	missense	probably damaging	1.00
R6058:Adamts20	UTSW	15	94330047	nonsense	probably null
R6217:Adamts20	UTSW	15	94338715	missense	probably benign	0.00
R6283:Adamts20	UTSW	15	94351721	missense	probably benign
R6354:Adamts20	UTSW	15	94347810	missense	probably damaging	1.00
R6415:Adamts20	UTSW	15	94324659	critical splice donor site	probably null
R6419:Adamts20	UTSW	15	94333675	missense	possibly damaging	0.84
R6476:Adamts20	UTSW	15	94361810	missense	probably benign	0.22
R6485:Adamts20	UTSW	15	94343971	missense	probably benign	0.17
R6517:Adamts20	UTSW	15	94283104	splice site	probably null
R6675:Adamts20	UTSW	15	94331316	critical splice donor site	probably null
R6863:Adamts20	UTSW	15	94379746	nonsense	probably null
R7186:Adamts20	UTSW	15	94322808	missense	possibly damaging	0.76
R7263:Adamts20	UTSW	15	94322891	missense	possibly damaging	0.52
R7441:Adamts20	UTSW	15	94353673	missense	probably damaging	1.00
R7519:Adamts20	UTSW	15	94325988	missense	possibly damaging	0.64
R7747:Adamts20	UTSW	15	94291587	nonsense	probably null
R7770:Adamts20	UTSW	15	94333698	missense	probably benign	0.02
R7816:Adamts20	UTSW	15	94322844	missense	probably benign	0.00
R7827:Adamts20	UTSW	15	94325933	missense	probably damaging	1.00
R7853:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R7894:Adamts20	UTSW	15	94351760	missense	probably damaging	1.00
R7951:Adamts20	UTSW	15	94341066	missense	probably damaging	1.00
R8233:Adamts20	UTSW	15	94291652	missense	probably benign	0.19
R8458:Adamts20	UTSW	15	94353640	missense	probably benign	0.02
R8709:Adamts20	UTSW	15	94341066	missense	probably damaging	1.00
R8719:Adamts20	UTSW	15	94344022	missense	probably damaging	0.99
R8728:Adamts20	UTSW	15	94331400	missense	probably benign	0.00
R8787:Adamts20	UTSW	15	94286413	missense	possibly damaging	0.83
R8801:Adamts20	UTSW	15	94360609	missense	probably damaging	1.00
R9055:Adamts20	UTSW	15	94283986	missense	probably damaging	0.98
R9069:Adamts20	UTSW	15	94338468	missense	probably benign	0.00
R9297:Adamts20	UTSW	15	94403440	missense	possibly damaging	0.88
R9318:Adamts20	UTSW	15	94403440	missense	possibly damaging	0.88
R9362:Adamts20	UTSW	15	94338745	missense	possibly damaging	0.86
R9658:Adamts20	UTSW	15	94351745	missense	probably damaging	1.00
R9747:Adamts20	UTSW	15	94283062	missense	probably damaging	1.00
R9769:Adamts20	UTSW	15	94353578	missense	probably damaging	1.00
R9795:Adamts20	UTSW	15	94403299	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- CAACCCGTGTTGTCCGGATG -3'
(R):5'- TCACCTGTCAACGTGCGTG -3'

Sequencing Primer
(F):5'- ATGCACGCTGCTCCATG -3'
(R):5'- TCCCGCTGATTGGTCGAC -3'

Posted On

2014-07-14